Cart 4 Product Products 451,08 € (empty)
-
1 x C1D-nuclea...113,40 € -
1 x PARK7-Park...113,40 € -
1 x STUB1-STIP...121,50 € -
No products
To be determined Shipping
451,08 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 4 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 451,08 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 451,08 €
View larger 
KCNA3-potassium voltage-gated channel, shaker-related subfamily, member 3 Gene
PTXBC035059
New product
Data sheet of KCNA3-potassium voltage-gated channel, shaker-related subfamily, member 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about KCNA3-potassium voltage-gated channel, shaker-related subfamily, member 3 Gene
| Brand: | ProteoGenix |
| Availability: | PRODUCT NOT AVAILABLE |
| Proteogenix catalog: | PTXBC035059 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | KCNA3 |
| Origin species: | Human |
| Product name: | KCNA3-potassium voltage-gated channel, shaker-related subfamily, member 3 Gene |
| Size: | 2ug |
| Accessions: | BC035059 |
| Gene id: | 3738 |
| Gene description: | potassium voltage-gated channel, shaker-related subfamily, member 3 |
| Synonyms: | HGK5; HLK3; HPCN3; HUKIII; MK3; PCN3; potassium voltage-gated channel subfamily A member 3; potassium channel 3; potassium channel, voltage gated shaker related subfamily A, member 3; potassium voltage-gated channel, shaker-related subfamily, member 3; type n potassium channel; voltage-gated K(+) channel HuKIII; voltage-gated potassium channel protein Kv1.3; voltage-gated potassium channel subunit Kv1.3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaccgtggtgcccggggaccacctgctggagccggaggtggccgatggtggaggggccccgcctcaaggcggctgtggcggcggcggctgcgaccgctacgagccgctgccgccctcactgccggccgcgggcgagcaggactgctgcggggagcgcgtggtcatcaacatctccgggctgcgcttcgagacgcagctgaagaccctttgccagttccccgagacgctgctgggcgaccccaagcggcgcatgaggtacttcgacccgctccgcaacgagtacttcttcgaccgcaaccggcccagcttcgacgccatcctctactactatcagtccgggggccgcatccgccggccggtcaacgtgcccatcgacattttctccgaggagatccgcttctaccagctgggcgaggaggccatggagaagttccgcgaggacgagggcttcctgcgggaggaggagcggcccttgccccgccgcgacttccagcgccaggtgtggctgctcttcgagtaccccgagagctccgggccggcccggggcatcgccatcgtgtccgtgctggtcatcctcatctccattgtcatcttctgcctggagacgctgccggagttccgcgacgagaaggactaccccgcctcgacgtcgcaggactcattcgaagcagccggcaacagcacgtcggggtcccgcgcaggagcctccagcttctccgatcccttcttcgtggtggagacgctgtgcatcatctggttctccttcgaactgctggtgcggttcttcgcttgtcctagcaaagccaccttctcgcgaaacatcatgaacctgatcgacattgtggccatcattccttattttatcactctgggtacagagctggccgaacgacagggcaatggacagcaggccatgtctctggccatcctgagggtcatccgcctggtaagggtcttccgcatcttcaagctgtcgcgccactccaaggggctgcagatcctcgggcaaacgctgaaggcgtccatgcgggagctgggattgctcatcttcttcctctttattggggtcatccttttctccagcgcggtctactttgccgaggcagacgaccccacttcaggtttcagcagcatcccggatgccttctggtgggcagtggtaaccatgacaacagtgggttacggcgatatgcacccagtgaccatagggggcaagattgtgggatctctctgtgccatcgccggtgtcttgaccatcgcattgccagttcccgtgattgtttccaacttcaattacttctaccaccgggagacagaaggggaagagcaatcccagtacatgcacgtgggaagttgccagcacctctcctcttcagccgaggagctccgaaaagcaaggagtaactcgactctgagtaagtcggagtatatggtgatcgaagaggggggtatgaaccatagcgctttcccccagacccctttcaaaacgggcaattccactgccacctgcaccacgaacaataatcccaactcttgtgtcaacatcaaaaagatattcaccgatgtttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2 - sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3B - immunoglobulin J polypeptide, linker protein for immunoglobulin alpha and mu polypeptides - TAF5-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa |