Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
IGJ-immunoglobulin J polypeptide, linker protein for immunoglobulin alpha and mu polypeptides Gene
PTXBC038982
New product
Data sheet of IGJ-immunoglobulin J polypeptide, linker protein for immunoglobulin alpha and mu polypeptides Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about IGJ-immunoglobulin J polypeptide, linker protein for immunoglobulin alpha and mu polypeptides Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC038982 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | IGJ |
| Origin species: | Human |
| Product name: | IGJ-immunoglobulin J polypeptide, linker protein for immunoglobulin alpha and mu polypeptides Gene |
| Size: | 2ug |
| Accessions: | BC038982 |
| Gene id: | 3512 |
| Gene description: | immunoglobulin J polypeptide, linker protein for immunoglobulin alpha and mu polypeptides |
| Synonyms: | IgJ chain; IGJ; IGCJ; JCH; immunoglobulin J chain; J chain; immunoglobulin J polypeptide, linker protein for immunoglobulin alpha and mu polypeptides; joining chain of multimeric IgA and IgM |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaagaaccatttgcttttctggggagtcctggcggtttttattaaggctgttcatgtgaaagcccaagaagatgaaaggattgttcttgttgacaacaaatgtaagtgtgcccggattacttccaggatcatccgttcttccgaagatcctaatgaggacattgtggagagaaacatccgaattattgttcctctgaacaacagggagaatatctctgatcccacctcaccattgagaaccagatttgtgtaccatttgtctgacctctgtaaaaaatgtgatcctacagaagtggagctggataatcagatagttactgctacccagagcaatatctgtgatgaagacagtgctacagagacctgctacacttatgacagaaacaagtgctacacagctgtggtcccactcgtatatggtggtgagaccaaaatggtggaaacagccttaaccccagatgcctgctatcctgactaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - TAF5-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa - guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 3 - asparagine-linked glycosylation 2, alpha-1,3-mannosyltransferase homolog (S. cerevisiae) - sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F |