GNAI3-guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 3 Gene View larger

GNAI3-guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 3 Gene

PTXBC025285

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GNAI3-guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GNAI3-guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC025285
Product type: DNA & cDNA
Ncbi symbol: GNAI3
Origin species: Human
Product name: GNAI3-guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 3 Gene
Size: 2ug
Accessions: BC025285
Gene id: 2773
Gene description: guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 3
Synonyms: 87U6; ARCND1; guanine nucleotide-binding protein G(k) subunit alpha; g(i) alpha-3; guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 3; G protein subunit alpha i3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggctgcacgttgagcgccgaagacaaggcggcagtggagcgaagcaagatgatcgaccgcaacttacgggaggacggggaaaaagcggccaaagaagtgaagctgctgctactcggtgctggagaatctggtaaaagcaccattgtgaaacagatgaaaatcattcatgaggatggctattcagaggatgaatgtaaacaatataaagtagttgtctacagcaatactatacagtccatcattgcaatcataagagccatgggacggctaaagattgactttggggaagctgccagggcagatgatgcccggcaattatttgttttagctggcagtgctgaagaaggagtcatgactccagaactagcaggagtgattaaacggttatggcgagatggtggggtacaagcttgcttcagcagatccagggaatatcagctcaatgattctgcttcatattatctaaatgatctggatagaatatcccagtctaactacattccaactcagcaagatgttcttcggacgagagtgaagaccacaggcattgtagaaacacatttcaccttcaaagacctatacttcaagatgtttgatgtaggtggccaaagatcagaacgaaaaaagtggattcactgttttgagggagtgacagcaattatcttctgtgtggccctcagtgattatgaccttgttctggctgaggacgaggagatgaaccgaatgcatgaaagcatgaaactgtttgacagcatttgtaataacaaatggtttacagaaacttcaatcattctcttccttaacaagaaagacctttttgaggaaaaaataaagaggagtccgttaactatctgttatccagaatacacaggttccaatacatatgaagaggcagctgcctatattcaatgccagtttgaagatctgaacagaagaaaagataccaaggagatctatactcacttcacctgtgccacagacacgaagaatgtgcagtttgtttttgatgctgttacagatgtcatcattaaaaacaacttaaaggaatgtggactttattga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - asparagine-linked glycosylation 2, alpha-1,3-mannosyltransferase homolog (S. cerevisiae)
- sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F
- sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3G
- sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A

Buy GNAI3-guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 3 Gene now

Add to cart