Login to display prices
Login to display prices
GNAI3-guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 3 Gene View larger

GNAI3-guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 3 Gene

PTXBC025285

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GNAI3-guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GNAI3-guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 3 Gene

Proteogenix catalog: PTXBC025285
Ncbi symbol: GNAI3
Product name: GNAI3-guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 3 Gene
Size: 2ug
Accessions: BC025285
Gene id: 2773
Gene description: guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 3
Synonyms: 87U6; ARCND1; guanine nucleotide-binding protein G(k) subunit alpha; g(i) alpha-3; guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 3; G protein subunit alpha i3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggctgcacgttgagcgccgaagacaaggcggcagtggagcgaagcaagatgatcgaccgcaacttacgggaggacggggaaaaagcggccaaagaagtgaagctgctgctactcggtgctggagaatctggtaaaagcaccattgtgaaacagatgaaaatcattcatgaggatggctattcagaggatgaatgtaaacaatataaagtagttgtctacagcaatactatacagtccatcattgcaatcataagagccatgggacggctaaagattgactttggggaagctgccagggcagatgatgcccggcaattatttgttttagctggcagtgctgaagaaggagtcatgactccagaactagcaggagtgattaaacggttatggcgagatggtggggtacaagcttgcttcagcagatccagggaatatcagctcaatgattctgcttcatattatctaaatgatctggatagaatatcccagtctaactacattccaactcagcaagatgttcttcggacgagagtgaagaccacaggcattgtagaaacacatttcaccttcaaagacctatacttcaagatgtttgatgtaggtggccaaagatcagaacgaaaaaagtggattcactgttttgagggagtgacagcaattatcttctgtgtggccctcagtgattatgaccttgttctggctgaggacgaggagatgaaccgaatgcatgaaagcatgaaactgtttgacagcatttgtaataacaaatggtttacagaaacttcaatcattctcttccttaacaagaaagacctttttgaggaaaaaataaagaggagtccgttaactatctgttatccagaatacacaggttccaatacatatgaagaggcagctgcctatattcaatgccagtttgaagatctgaacagaagaaaagataccaaggagatctatactcacttcacctgtgccacagacacgaagaatgtgcagtttgtttttgatgctgttacagatgtcatcattaaaaacaacttaaaggaatgtggactttattga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: