FLAD1-FAD1 flavin adenine dinucleotide synthetase homolog (S. cerevisiae) Gene View larger

FLAD1-FAD1 flavin adenine dinucleotide synthetase homolog (S. cerevisiae) Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FLAD1-FAD1 flavin adenine dinucleotide synthetase homolog (S. cerevisiae) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about FLAD1-FAD1 flavin adenine dinucleotide synthetase homolog (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC021096
Product type: DNA & cDNA
Ncbi symbol: FLAD1
Origin species: Human
Product name: FLAD1-FAD1 flavin adenine dinucleotide synthetase homolog (S. cerevisiae) Gene
Size: 2ug
Accessions: BC021096
Gene id: 80308
Gene description: FAD1 flavin adenine dinucleotide synthetase homolog (S. cerevisiae)
Synonyms: FAD1; FADS; LSMFLAD; PP591; FAD synthase; FAD pyrophosphorylase; FAD-synthetase; FMN adenylyltransferase; Fad1, flavin adenine dinucleotide synthetase, homolog; flavin adenine dinucleotide synthetase 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacatctagggcctctgaactttctccggggcgcagcgtgacggctggcatcatcattgttggagatgagatccttaagggacacactcaggacaccaacaccttctttctgtgccggacactgcgctccctaggggtccaggtttgccgagtctcagttgtacctgatgaggtagccaccattgcagctgaggtcacttctttctccaaccgcttcacccatgtcctcacagcagggggcatcggccccactcatgatgatgtgacctttgaggcagtggcacaggcctttggagatgagctgaagccacaccccaagttggaagcagccaccaaagccctaggaggggaaggctgggagaagctatcattggtgccctcctctgcccgcctgcattatggcacagatccttgcactggtcaacctttcagattccctctggtctccgtccgaaacgtctacctcttcccaggcattccagagctgctgcggcgggtgctggaggggatgaagggactattccaaaacccagctgttcagttccactcaaaggagctatatgtggctgctgatgaagcctccatcgcccccattctggctgaggcccaggcccactttggacgtaggcttggcctgggttcctaccctgactggggcagcaactactatcaggtgaagctgactctagactcagaggaagaaggacccctggaggaatgcttggcctacctgactgcccgtttgccccagggatcgctggtcccctacatgcccaacgctgtggagcaggccagtgaggctgtatacaaactcgctgaatcagggtcttctttggggaaaaaggtggcaggtgccctacagaccattgagacctccctggctcagtacagcctcacccagctctgtgtgggcttcaacgggggcaaagactgcactgccctcctgcacctcttccatgcagctgtgcagaggaaattacctgatgttccaaaccccctccagatcctgtatatccgcagcatctcccctttccctgagctggaacagtttctacaggacactatcaagaggtataatctgcagatgttggaagctgagggcagcatgaagcaggccctgggtgaactgcaggcacggcacccccagctggaggctgtccttatgggcacccgccggactgacccctactcctgtagcctctgccctttcagccccactgacccaggctggcccgcattcatgcgcatcaacccactgctggactggacctacagagacatctgggattttctgcgtcagctgtttgtcccatactgtatcctgtatgaccgaggatacacatcactggggagtcgggagaataccgtgcggaacccggccctgaagtgcctgagcccaggaggacaccccacataccgtccagcctatctactggagaacgaagaagaggagcggaactcccgcacatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - serpin peptidase inhibitor, clade D (heparin cofactor), member 1
- potassium voltage-gated channel, shaker-related subfamily, member 3
- guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2
- sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3B

Buy FLAD1-FAD1 flavin adenine dinucleotide synthetase homolog (S. cerevisiae) Gene now

Add to cart