RIC8A-resistance to inhibitors of cholinesterase 8 homolog A (C. elegans) Gene View larger

RIC8A-resistance to inhibitors of cholinesterase 8 homolog A (C. elegans) Gene

PTXBC011821

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RIC8A-resistance to inhibitors of cholinesterase 8 homolog A (C. elegans) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RIC8A-resistance to inhibitors of cholinesterase 8 homolog A (C. elegans) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC011821
Product type: DNA & cDNA
Ncbi symbol: RIC8A
Origin species: Human
Product name: RIC8A-resistance to inhibitors of cholinesterase 8 homolog A (C. elegans) Gene
Size: 2ug
Accessions: BC011821
Gene id: 60626
Gene description: resistance to inhibitors of cholinesterase 8 homolog A (C. elegans)
Synonyms: RIC8; synembryn-A; resistance to inhibitors of cholinesterase 8 homolog A; RIC8 guanine nucleotide exchange factor A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggatgttgtactggagtccctcaagtgcctgtgcaacctcgtgctcagcagccctgtggcacagatgctggcagcagaggcccgcctagtggtgaagctcacagagcgtgtggggctgtaccgtgagaggagcttcccccacgatgtccagttctttgacttgcggctcctcttcctgctaacggcactccgcaccgatgtgcgccagcagctgtttcaggagctgaaaggagtgcgcctgctaactgacacactggagctgacgctgggggtgactcctgaagggaacccacccacgctccttccttcccaagagactgagcgggccatggagatcctcaaagtgctcttcaacatcaccctggactccatcaagggggaggtggacgaggaagacgctgccctttaccgacacctggggacccttctccggcactgtgtgatgatcgctactgctggagaccgcacagaggagttccacggccacgcagtgaacctcctggggaacttgcccctcaagtgtctggatgttctcctcaccctggagccacatggagactccacggagttcatgggagtgaatatggatgtgattcgtgccctcctcatcttcctagagaagcgtttgcacaagacacacaggctgaaggagagtgtagctcccgtgctgagcgtgctgactgaatgtgcccggatgcaccgcccagccaggaagttcctgaaggcccaggtgctgccccctctgcgggatgtgaggacacggcctgaggttggggagatgctgcggaacaagcttgtccgcctcatgacacacctggacacagatgtgaagagggtggctgccgagttcttgtttgtcctgtgctctgagagtgtgccccgattcatcaagtacacaggctatgggaatgctgctggccttctggctgccaggggcctcatggcaggaggccggcccgagggccagtactcagaggatgaggacacagacacagatgagtacaaggaagccaaagccagcataaaccctgtgaccgggagggtggaggagaagccgcctaaccctatggagggcatgacagaggagcagaaggagcacgaggccatgaagctggtgaccatgtttgacaagctctccaggaacagagtcatccagccaatggggatgagtccccggggtcatcttacgtccctgcaggatgccatgtgcgagactatggagcagcagctctcctcggaccctgactcggaccctgactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - nuclear fragile X mental retardation protein interacting protein 1
- small glutamine-rich tetratricopeptide repeat (TPR)-containing, beta
- melanoma antigen family A, 1 (directs expression of antigen MZ2-E)
- menage a trois homolog 1, cyclin H assembly factor (Xenopus laevis)

Buy RIC8A-resistance to inhibitors of cholinesterase 8 homolog A (C. elegans) Gene now

Add to cart