Cart 2 Product Products 217,11 € (empty)
-
-
1 x BAX-BCL2-a...113,40 €
No products
To be determined Shipping
217,11 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 2 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 217,11 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 217,11 €
View larger 
RIC8A-resistance to inhibitors of cholinesterase 8 homolog A (C. elegans) Gene
PTXBC011821
New product
Data sheet of RIC8A-resistance to inhibitors of cholinesterase 8 homolog A (C. elegans) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RIC8A-resistance to inhibitors of cholinesterase 8 homolog A (C. elegans) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC011821 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RIC8A |
| Origin species: | Human |
| Product name: | RIC8A-resistance to inhibitors of cholinesterase 8 homolog A (C. elegans) Gene |
| Size: | 2ug |
| Accessions: | BC011821 |
| Gene id: | 60626 |
| Gene description: | resistance to inhibitors of cholinesterase 8 homolog A (C. elegans) |
| Synonyms: | RIC8; synembryn-A; resistance to inhibitors of cholinesterase 8 homolog A; RIC8 guanine nucleotide exchange factor A |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggatgttgtactggagtccctcaagtgcctgtgcaacctcgtgctcagcagccctgtggcacagatgctggcagcagaggcccgcctagtggtgaagctcacagagcgtgtggggctgtaccgtgagaggagcttcccccacgatgtccagttctttgacttgcggctcctcttcctgctaacggcactccgcaccgatgtgcgccagcagctgtttcaggagctgaaaggagtgcgcctgctaactgacacactggagctgacgctgggggtgactcctgaagggaacccacccacgctccttccttcccaagagactgagcgggccatggagatcctcaaagtgctcttcaacatcaccctggactccatcaagggggaggtggacgaggaagacgctgccctttaccgacacctggggacccttctccggcactgtgtgatgatcgctactgctggagaccgcacagaggagttccacggccacgcagtgaacctcctggggaacttgcccctcaagtgtctggatgttctcctcaccctggagccacatggagactccacggagttcatgggagtgaatatggatgtgattcgtgccctcctcatcttcctagagaagcgtttgcacaagacacacaggctgaaggagagtgtagctcccgtgctgagcgtgctgactgaatgtgcccggatgcaccgcccagccaggaagttcctgaaggcccaggtgctgccccctctgcgggatgtgaggacacggcctgaggttggggagatgctgcggaacaagcttgtccgcctcatgacacacctggacacagatgtgaagagggtggctgccgagttcttgtttgtcctgtgctctgagagtgtgccccgattcatcaagtacacaggctatgggaatgctgctggccttctggctgccaggggcctcatggcaggaggccggcccgagggccagtactcagaggatgaggacacagacacagatgagtacaaggaagccaaagccagcataaaccctgtgaccgggagggtggaggagaagccgcctaaccctatggagggcatgacagaggagcagaaggagcacgaggccatgaagctggtgaccatgtttgacaagctctccaggaacagagtcatccagccaatggggatgagtccccggggtcatcttacgtccctgcaggatgccatgtgcgagactatggagcagcagctctcctcggaccctgactcggaccctgactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - nuclear fragile X mental retardation protein interacting protein 1 - small glutamine-rich tetratricopeptide repeat (TPR)-containing, beta - melanoma antigen family A, 1 (directs expression of antigen MZ2-E) - menage a trois homolog 1, cyclin H assembly factor (Xenopus laevis) |