NUFIP1-nuclear fragile X mental retardation protein interacting protein 1 Gene View larger

NUFIP1-nuclear fragile X mental retardation protein interacting protein 1 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NUFIP1-nuclear fragile X mental retardation protein interacting protein 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about NUFIP1-nuclear fragile X mental retardation protein interacting protein 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC017745
Product type: DNA & cDNA
Ncbi symbol: NUFIP1
Origin species: Human
Product name: NUFIP1-nuclear fragile X mental retardation protein interacting protein 1 Gene
Size: 2ug
Accessions: BC017745
Gene id: 26747
Gene description: nuclear fragile X mental retardation protein interacting protein 1
Synonyms: NUFIP1, FMR1 interacting protein 1; NUFIP; bA540M5.1; nuclear fragile X mental retardation-interacting protein 1; nuclear FMRP-interacting protein 1; nuclear fragile X mental retardation protein interacting protein 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcatgctcctggcatgaagaagatcaagttagacactccagaggaaattgcacggtggagggaagaaagaaggaaaaactatccaactctggccaatattgaaaggaagaagaagttaaaacttgaaaaggagaagagaggagcagtattgacaacaacacaatatggcaagatgaaggggatgtccagacattcacaaatggcaaagatcagaagtcctggcaagaatcacaaatggaaaaacgacaattctagacagagagcagtcactggatcaggcagtcacttgtgtgatttgaagctagaaggtccaccggaggcaaatgcagatcctcttggtgttttgataaacagtgattctgagtctgataaggaggagaaaccacaacattctgtgatacccaaggaagtgacaccagccctatgctcactaatgagtagctatggcagtctttcagggtcagagagtgagccagaagaaactcccatcaagactgaagcagacgttttggcagaaaaccaggttcttgatagcagtgctcctaagagtccaagtcaagatgttaaagcaactgttagaaatttttcagaagccaagagtgagaaccgaaagaaaagctttgaaaaaacaaaccctaagaggaaaaaagattatcacaactatcaaacgttattcgaaccaagaacacaccatccatatctcttggaaatgcttctagctccggacattcgacatgaaagaaatgtgattttgcagtgtgttcggtacatcattaaaaaagacttttttggactggatactaattctgcgaaaagtaaagatgtatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - small glutamine-rich tetratricopeptide repeat (TPR)-containing, beta
- melanoma antigen family A, 1 (directs expression of antigen MZ2-E)
- menage a trois homolog 1, cyclin H assembly factor (Xenopus laevis)
- UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 4

Buy NUFIP1-nuclear fragile X mental retardation protein interacting protein 1 Gene now

Add to cart