FAM62B-family with sequence similarity 62 (C2 domain containing) member B Gene View larger

FAM62B-family with sequence similarity 62 (C2 domain containing) member B Gene

PTXBC013957

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FAM62B-family with sequence similarity 62 (C2 domain containing) member B Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FAM62B-family with sequence similarity 62 (C2 domain containing) member B Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC013957
Product type: DNA & cDNA
Ncbi symbol: FAM62B
Origin species: Human
Product name: FAM62B-family with sequence similarity 62 (C2 domain containing) member B Gene
Size: 2ug
Accessions: BC013957
Gene id: 57488
Gene description: family with sequence similarity 62 (C2 domain containing) member B
Synonyms: FAM62B; CHR2SYT; E-Syt2; extended synaptotagmin-2; chr2 synaptotagmin; extended synaptotagmin like protein 2; extended synaptotagmin protein 2; family with sequence similarity 62 (C2 domain containing), member B; extended synaptotagmin 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcagttgggcacaaggcccaggagagcaagattcgatacaaaaccaatgaacctgtgtgggaggaaaacttcactttcttcattcacaatcccaagcgccaggaccttgaagttgaggtcagagacgagcagcaccagtgttccctggggaacctgaaggtccccctcagccagctgctcaccagtgaggacatgactgtgagccagcgcttccagctcagtaactcgggtccaaacagcaccatcaagatgaagattgccctgcgggtgctccatctcgaaaagcgagaaaggcctccagaccaccaacactcagctcaagtcaaacgtccctctgtgtccaaagaggggaggaaaacatccatcaaatctcatatgtctgggtctccaggccctggtggcagcaacacagctccatccacaccagtcattgggggcagtgataagcctggtatggaagaaaaggcccagccccctgaggccggccctcaggggctgcacgacctgggcagaagctcctccagcctcctggcctccccaggccacatctcagtcaaggagccgacccccagcatcgcctcggacatctcgctgcccatcgccacccaggagctgcggcaaaggctgaggcagctggaaaacgggacgaccctgggacagtctccactggggcagatccagctgaccatccggcacagctcgcagagaaacaagcttatcgtggtcgtgcatgcctgcagaaacctcattgccttctctgaagacggctctgacccctatgtccgcatgtatttattaccagacaagaggcggtcaggaaggaggaaaacacacgtgtcaaagaaaacattaaatccagtgtttgatcaaagctttgatttcagtgtttcgttaccagaagtgcagaggagaacgctcgacgttgccgtgaagaacagtggcggcttcctgtccaaagacaaagggctccttggcaaagtattggttgctctggcatctgaagaacttgccaaaggctggacccagtggtatgacctcacggaagatgggacgaggcctcaggcgatgacatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - HSPA (heat shock 70kDa) binding protein, cytoplasmic cochaperone 1
- UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 3
- resistance to inhibitors of cholinesterase 8 homolog A (C. elegans)
- nuclear fragile X mental retardation protein interacting protein 1

Buy FAM62B-family with sequence similarity 62 (C2 domain containing) member B Gene now

Add to cart