Login to display prices
Login to display prices
FAM62B-family with sequence similarity 62 (C2 domain containing) member B Gene View larger

FAM62B-family with sequence similarity 62 (C2 domain containing) member B Gene

PTXBC013957

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FAM62B-family with sequence similarity 62 (C2 domain containing) member B Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FAM62B-family with sequence similarity 62 (C2 domain containing) member B Gene

Proteogenix catalog: PTXBC013957
Ncbi symbol: FAM62B
Product name: FAM62B-family with sequence similarity 62 (C2 domain containing) member B Gene
Size: 2ug
Accessions: BC013957
Gene id: 57488
Gene description: family with sequence similarity 62 (C2 domain containing) member B
Synonyms: FAM62B; CHR2SYT; E-Syt2; extended synaptotagmin-2; chr2 synaptotagmin; extended synaptotagmin like protein 2; extended synaptotagmin protein 2; family with sequence similarity 62 (C2 domain containing), member B; extended synaptotagmin 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcagttgggcacaaggcccaggagagcaagattcgatacaaaaccaatgaacctgtgtgggaggaaaacttcactttcttcattcacaatcccaagcgccaggaccttgaagttgaggtcagagacgagcagcaccagtgttccctggggaacctgaaggtccccctcagccagctgctcaccagtgaggacatgactgtgagccagcgcttccagctcagtaactcgggtccaaacagcaccatcaagatgaagattgccctgcgggtgctccatctcgaaaagcgagaaaggcctccagaccaccaacactcagctcaagtcaaacgtccctctgtgtccaaagaggggaggaaaacatccatcaaatctcatatgtctgggtctccaggccctggtggcagcaacacagctccatccacaccagtcattgggggcagtgataagcctggtatggaagaaaaggcccagccccctgaggccggccctcaggggctgcacgacctgggcagaagctcctccagcctcctggcctccccaggccacatctcagtcaaggagccgacccccagcatcgcctcggacatctcgctgcccatcgccacccaggagctgcggcaaaggctgaggcagctggaaaacgggacgaccctgggacagtctccactggggcagatccagctgaccatccggcacagctcgcagagaaacaagcttatcgtggtcgtgcatgcctgcagaaacctcattgccttctctgaagacggctctgacccctatgtccgcatgtatttattaccagacaagaggcggtcaggaaggaggaaaacacacgtgtcaaagaaaacattaaatccagtgtttgatcaaagctttgatttcagtgtttcgttaccagaagtgcagaggagaacgctcgacgttgccgtgaagaacagtggcggcttcctgtccaaagacaaagggctccttggcaaagtattggttgctctggcatctgaagaacttgccaaaggctggacccagtggtatgacctcacggaagatgggacgaggcctcaggcgatgacatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: