PPP2R3B-protein phosphatase 2 (formerly 2A), regulatory subunit B'', beta Gene View larger

PPP2R3B-protein phosphatase 2 (formerly 2A), regulatory subunit B'', beta Gene

PTXBC009032

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PPP2R3B-protein phosphatase 2 (formerly 2A), regulatory subunit B'', beta Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PPP2R3B-protein phosphatase 2 (formerly 2A), regulatory subunit B'', beta Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009032
Product type: DNA & cDNA
Ncbi symbol: PPP2R3B
Origin species: Human
Product name: PPP2R3B-protein phosphatase 2 (formerly 2A), regulatory subunit B'', beta Gene
Size: 2ug
Accessions: BC009032
Gene id: 28227
Gene description: protein phosphatase 2 (formerly 2A), regulatory subunit B'', beta
Synonyms: NYREN8; PPP2R3L; PPP2R3LY; PR48; serine/threonine-protein phosphatase 2A regulatory subunit B'' subunit beta; NY-REN-8 antigen; PP2A, subunit B, PR48 isoform; protein phosphatase 2 (formerly 2A), regulatory subunit B'', beta; protein phosphatase 2, regulatory subunit B'', beta; serine/threonine protein phosphatase 2A, 48kDa regulatory subunit B; protein phosphatase 2 regulatory subunit B''beta
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacctggacggggacggcgccctgtccatgttcgagctcgagtacttctacgaggagcagtgccgaaggctggacagcatggccatcgaggccctgcccttccaggactgcctctgccagatgctggacctggtcaagccgaggactgaagggaagatcacgctgcaggacctgaagcgctgcaagctggccaacgtcttcttcgacaccttcttcaacatcgagaagtacctcgaccacgagcagaaagagcagatctccctgctcagggacggtgacagcggcggccccgagctctcggactgggagaagtacgcggccgaggagtacgacatcctggtggccgaggagaccgcgggagagccctgggaggacgggttcgaggccgagctcagccccgtggagcagaagctgagtgcgctgcgctccccgctggcccagaggcccttcttcgaggcgccctcaccgctgggcgccgtggacctgtacgagtacgcgtgcggggacgaggacctggagccgctgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - toll-interleukin 1 receptor (TIR) domain containing adaptor protein
- eukaryotic translation initiation factor 2B, subunit 2 beta, 39kDa
- family with sequence similarity 62 (C2 domain containing) member B
- HSPA (heat shock 70kDa) binding protein, cytoplasmic cochaperone 1

Buy PPP2R3B-protein phosphatase 2 (formerly 2A), regulatory subunit B'', beta Gene now

Add to cart