EIF2S3-eukaryotic translation initiation factor 2, subunit 3 gamma, 52kDa Gene View larger

EIF2S3-eukaryotic translation initiation factor 2, subunit 3 gamma, 52kDa Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of EIF2S3-eukaryotic translation initiation factor 2, subunit 3 gamma, 52kDa Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about EIF2S3-eukaryotic translation initiation factor 2, subunit 3 gamma, 52kDa Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC019906
Product type: DNA & cDNA
Ncbi symbol: EIF2S3
Origin species: Human
Product name: EIF2S3-eukaryotic translation initiation factor 2, subunit 3 gamma, 52kDa Gene
Size: 2ug
Accessions: BC019906
Gene id: 1968
Gene description: eukaryotic translation initiation factor 2, subunit 3 gamma, 52kDa
Synonyms: EIF2; EIF2G; EIF2gamma; MRXSBRK; eIF-2gA; eukaryotic translation initiation factor 2 subunit 3; eIF-2-gamma X; eIF-2gX; eukaryotic translation initiation factor 2 subunit gamma X; eukaryotic translation initiation factor 2, subunit 3 gamma, 52kDa; eukaryotic translation initiation factor 2G; eukaryotic translation initiation factor 2 subunit gamma
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgggcggagaagctggagtgactctagggcagccgcatctttcgcgtcaggatctcaccaccttggatgttaccaagttgacgccactttcacacgaagttatcagcagacaagccacaattaacataggtacaattggtcatgtagctcatgggaaatccacagtcgtcaaagctatttctggagttcatactgtcaggttcaaaaatgaactagaaagaaatattacaatcaagcttggatatgctaatgctaagatttataagcttgatgacccaagttgccctcggccagaatgttatagatcttgtgggagcagtacacctgacgagtttcctacggacattccagggaccaaagggaacttcaaattagtcagacatgtttcctttgttgactgtcctggccacgatattttgatggctactatgctgaacggtgcagcagtgatggatgcagctcttctgttgatagctggtaatgaatcttgccctcagcctcagacatcggaacacctggctgctatagagatcatgaaactgaagcatattttgattctacaaaataaaattgatttggtaaaagaaagtcaggctaaagaacaatacgagcagatccttgcatttgtccaaggtacagtagcagagggagctcccattattccaatttcagctcagctgaaatacaatattgaagttgtttgtgagtacatagtaaagaaaattccagtacccccaagagactttacttcagagccccggcttattgttattagatcttttgatgtcaacaaacctggctgtgaagttgatgaccttaagggaggtgtagctggtggtagtatcctaaaaggagtattaaaggtgggccaggagatagaagtaagacctggtattgtttccaaagatagtgaaggaaaactcatgtgtaaaccaatcttttccaaaattgtatcactttttgcggagcataatgatctgcaatatgctgctccaggcggtcttattggagttggaacaaaaattgaccccactttgtgccgggctgacagaatggtggggcaagtacttggtgcagtcggagctttacctgagatattcacagaattggaaatttcctatttcctgcttagacggcttctaggtgtacgcactgaaggagacaagaaagcagcaaaggttcaaaagctgtctaagaatgaagtgctcatggtgaacataggatccctgtcaacaggagggagagttagtgctgtcaaggccgatttgggtaaaattgttttgaccaatccagtgtgcacagaggtaggagaaaaaattgcccttagccgaagagttgaaaaacactggcgtttaattggttggggtcagataagaagaggagtgacaatcaagccaacagtagatgatgactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - leucine-rich repeats and calponin homology (CH) domain containing 4
- ATP synthase, H+ transporting, mitochondrial F0 complex, subunit F6
- UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 2
- collagen, type IV, alpha 3 (Goodpasture antigen) binding protein

Buy EIF2S3-eukaryotic translation initiation factor 2, subunit 3 gamma, 52kDa Gene now

Add to cart