GNA15-guanine nucleotide binding protein (G protein), alpha 15 (Gq class) Gene View larger

GNA15-guanine nucleotide binding protein (G protein), alpha 15 (Gq class) Gene

PTXBC013585

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GNA15-guanine nucleotide binding protein (G protein), alpha 15 (Gq class) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GNA15-guanine nucleotide binding protein (G protein), alpha 15 (Gq class) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC013585
Product type: DNA & cDNA
Ncbi symbol: GNA15
Origin species: Human
Product name: GNA15-guanine nucleotide binding protein (G protein), alpha 15 (Gq class) Gene
Size: 2ug
Accessions: BC013585
Gene id: 2769
Gene description: guanine nucleotide binding protein (G protein), alpha 15 (Gq class)
Synonyms: GNA16; guanine nucleotide-binding protein subunit alpha-15; G-protein subunit alpha-16; epididymis tissue protein Li 17E; g alpha-15; g alpha-16; guanine nucleotide binding protein (G protein), alpha 15 (Gq class); guanine nucleotide-binding protein subunit alpha-16; G protein subunit alpha 15
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcccgctcgctgacctggcgctgctgcccctggtgcctgacggaggatgagaaggccgccgcccgggtggaccaggagatcaacaggatcctcttggagcagaagaagcaggaccgcggggagctgaagctgctgcttttgggcccaggcgagagcgggaagagcaccttcatcaagcagatgcggatcatccacggcgccggctactcggaggaggagcgcaagggcttccggcccctggtctaccagaacatcttcgtgtccatgcgggccatgatcgaggccatggagcggctgcagattccattcagcaggcccgagagcaagcaccacgctagcctggtcatgagccaggacccctataaagtgaccacgtttgagaagcgctacgctgcggccatgcagtggctgtggagggatgccggcatccgggcctgctatgagcgtcggcgggaattccacctgctcgattcagccgtgtactacctgtcccacctggagcgcatcaccgaggagggctacgtccccacagctcaggacgtgctccgcagccgcatgcccaccactggcatcaacgagtactgcttctccgtgcagaaaaccaacctgcggatcgtggacgtcgggggccagaagtcagagcgtaagaaatggatccattgtttcgagaacgtgatcgccctcatctacctggcctcactgagtgaatacgaccagtgcctggaggagaacaaccaggagaaccgcatgaaggagagcctcgcattgtttgggactatcctggaactaccctggttcaaaagcacatccgtcatcctctttctcaacaaaaccgacatcctggaggagaaaatccccacctcccacctggctacctatttccccagtttccagggccctaagcaggatgctgaggcagccaagaggttcatcctggacatgtacacgaggatgtacaccgggtgcgtggacggccccgagggcagcaagaagggcgcacgatcccgacgcctcttcagccactacacatgtgccacagacacacagaacatccgcaaggtcttcaaggacgtgcgggactcggtgctcgcccgctacctggacgagatcaacctgctgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 3
- single immunoglobulin and toll-interleukin 1 receptor (TIR) domain
- eukaryotic translation initiation factor 2, subunit 3 gamma, 52kDa
- leucine-rich repeats and calponin homology (CH) domain containing 4

Buy GNA15-guanine nucleotide binding protein (G protein), alpha 15 (Gq class) Gene now

Add to cart