PPP2R3B-protein phosphatase 2 (formerly 2A), regulatory subunit B'', beta Gene View larger

PPP2R3B-protein phosphatase 2 (formerly 2A), regulatory subunit B'', beta Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PPP2R3B-protein phosphatase 2 (formerly 2A), regulatory subunit B'', beta Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PPP2R3B-protein phosphatase 2 (formerly 2A), regulatory subunit B'', beta Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC011180
Product type: DNA & cDNA
Ncbi symbol: PPP2R3B
Origin species: Human
Product name: PPP2R3B-protein phosphatase 2 (formerly 2A), regulatory subunit B'', beta Gene
Size: 2ug
Accessions: BC011180
Gene id: 28227
Gene description: protein phosphatase 2 (formerly 2A), regulatory subunit B'', beta
Synonyms: NYREN8; PPP2R3L; PPP2R3LY; PR48; serine/threonine-protein phosphatase 2A regulatory subunit B'' subunit beta; NY-REN-8 antigen; PP2A, subunit B, PR48 isoform; protein phosphatase 2 (formerly 2A), regulatory subunit B'', beta; protein phosphatase 2, regulatory subunit B'', beta; serine/threonine protein phosphatase 2A, 48kDa regulatory subunit B; protein phosphatase 2 regulatory subunit B''beta
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgatagacaggatcttctcaggagcagtcacacgaggcagaaaagtgcagaaggaagggaagatcagctatgccgactttgtctggtttttgatctctgaggaagacaaaaaaacaccgaccagcatcgagtactggttccgctgcatggacctggacggggacggcgccctgtccatgttcgagctcgagtacttctacgaggagcagtgccgaaggctggacagcatggccatcgaggccctgcccttccaggactgcctctgccagatgctggacctggtcaagccgaggactgaagggaagatcacgctgcaggacctgaagcgctgcaagctggccaacgtcttcttcgacaccttcttcaacatcgagaagtacctcgaccacgagcagaaagagcagatctccctgctcagggacggtgacagcggcggccccgagctctcggactgggagaagtacgcggccgaggagtacgacatcctggtggccgaggagaccgcgggagagccctgggaggacgggttcgaggccgagctcagccctgtggagcagaagctgagtgcgctgcgctccccgctggcccagaggcccttcttcgaggcgccctcaccgctgggcgccgtggacctgtacgagtacgcatgcggggacgaggacctggagccgctgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - guanine nucleotide binding protein (G protein), alpha 15 (Gq class)
- UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 3
- single immunoglobulin and toll-interleukin 1 receptor (TIR) domain
- eukaryotic translation initiation factor 2, subunit 3 gamma, 52kDa

Buy PPP2R3B-protein phosphatase 2 (formerly 2A), regulatory subunit B'', beta Gene now

Add to cart