Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PPP2R3B-protein phosphatase 2 (formerly 2A), regulatory subunit B'', beta Gene
PTXBC011180
New product
Data sheet of PPP2R3B-protein phosphatase 2 (formerly 2A), regulatory subunit B'', beta Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PPP2R3B-protein phosphatase 2 (formerly 2A), regulatory subunit B'', beta Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC011180 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PPP2R3B |
| Origin species: | Human |
| Product name: | PPP2R3B-protein phosphatase 2 (formerly 2A), regulatory subunit B'', beta Gene |
| Size: | 2ug |
| Accessions: | BC011180 |
| Gene id: | 28227 |
| Gene description: | protein phosphatase 2 (formerly 2A), regulatory subunit B'', beta |
| Synonyms: | NYREN8; PPP2R3L; PPP2R3LY; PR48; serine/threonine-protein phosphatase 2A regulatory subunit B'' subunit beta; NY-REN-8 antigen; PP2A, subunit B, PR48 isoform; protein phosphatase 2 (formerly 2A), regulatory subunit B'', beta; protein phosphatase 2, regulatory subunit B'', beta; serine/threonine protein phosphatase 2A, 48kDa regulatory subunit B; protein phosphatase 2 regulatory subunit B''beta |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgatagacaggatcttctcaggagcagtcacacgaggcagaaaagtgcagaaggaagggaagatcagctatgccgactttgtctggtttttgatctctgaggaagacaaaaaaacaccgaccagcatcgagtactggttccgctgcatggacctggacggggacggcgccctgtccatgttcgagctcgagtacttctacgaggagcagtgccgaaggctggacagcatggccatcgaggccctgcccttccaggactgcctctgccagatgctggacctggtcaagccgaggactgaagggaagatcacgctgcaggacctgaagcgctgcaagctggccaacgtcttcttcgacaccttcttcaacatcgagaagtacctcgaccacgagcagaaagagcagatctccctgctcagggacggtgacagcggcggccccgagctctcggactgggagaagtacgcggccgaggagtacgacatcctggtggccgaggagaccgcgggagagccctgggaggacgggttcgaggccgagctcagccctgtggagcagaagctgagtgcgctgcgctccccgctggcccagaggcccttcttcgaggcgccctcaccgctgggcgccgtggacctgtacgagtacgcatgcggggacgaggacctggagccgctgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - guanine nucleotide binding protein (G protein), alpha 15 (Gq class) - UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 3 - single immunoglobulin and toll-interleukin 1 receptor (TIR) domain - eukaryotic translation initiation factor 2, subunit 3 gamma, 52kDa |