Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
NUDT2-nudix (nucleoside diphosphate linked moiety X)-type motif 2 Gene
PTXBC004926
New product
Data sheet of NUDT2-nudix (nucleoside diphosphate linked moiety X)-type motif 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NUDT2-nudix (nucleoside diphosphate linked moiety X)-type motif 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC004926 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NUDT2 |
| Origin species: | Human |
| Product name: | NUDT2-nudix (nucleoside diphosphate linked moiety X)-type motif 2 Gene |
| Size: | 2ug |
| Accessions: | BC004926 |
| Gene id: | 318 |
| Gene description: | nudix (nucleoside diphosphate linked moiety X)-type motif 2 |
| Synonyms: | APAH1; bis(5'-nucleosyl)-tetraphosphatase [asymmetrical]; Ap4A hydrolase 1; Ap4Aase; bis(5'-nucleosyl)-tetraphosphatase (asymmetrical); diadenosine 5',5'''-P1,P4-tetraphosphate asymmetrical hydrolase; diadenosine 5',5''-P1,P4-tetraphosphate pyrophosphohydrolase; diadenosine tetraphosphatase; nucleoside diphosphate-linked moiety X motif 2; nudix (nucleoside diphosphate linked moiety X)-type motif 2; nudix motif 2; nudix hydrolase 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccttgagagcatgtggcttgatcatcttccgaagatgcctcattcccaaagtggacaacaatgcaattgagtttttactgctgcaggcatcagatggcattcatcactggactcctcccaaaggccatgtggaaccaggagaggatgacttggaaacagccctgagggagacccaagaggaagcaggcatagaagcaggccagctgaccattattgaggggttcaaaagggaactcaattatgtggccaggaacaagcctaaaacagtcatttactggctggcggaggtgaaggactatgacgtggagatccgcctctcccatgagcaccaagcctaccgctggctggggctggaggaggcctgccagttggctcagttcaaggagatgaaggcagcgctccaagaaggacaccagtttctttgctccatagaggcctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - v-rel reticuloendotheliosis viral oncogene homolog A (avian) - interferon-induced protein with tetratricopeptide repeats 3 - protein kinase C and casein kinase substrate in neurons 2 - carcinoembryonic antigen-related cell adhesion molecule 5 |