NUDT2-nudix (nucleoside diphosphate linked moiety X)-type motif 2 Gene View larger

NUDT2-nudix (nucleoside diphosphate linked moiety X)-type motif 2 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NUDT2-nudix (nucleoside diphosphate linked moiety X)-type motif 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about NUDT2-nudix (nucleoside diphosphate linked moiety X)-type motif 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC004926
Product type: DNA & cDNA
Ncbi symbol: NUDT2
Origin species: Human
Product name: NUDT2-nudix (nucleoside diphosphate linked moiety X)-type motif 2 Gene
Size: 2ug
Accessions: BC004926
Gene id: 318
Gene description: nudix (nucleoside diphosphate linked moiety X)-type motif 2
Synonyms: APAH1; bis(5'-nucleosyl)-tetraphosphatase [asymmetrical]; Ap4A hydrolase 1; Ap4Aase; bis(5'-nucleosyl)-tetraphosphatase (asymmetrical); diadenosine 5',5'''-P1,P4-tetraphosphate asymmetrical hydrolase; diadenosine 5',5''-P1,P4-tetraphosphate pyrophosphohydrolase; diadenosine tetraphosphatase; nucleoside diphosphate-linked moiety X motif 2; nudix (nucleoside diphosphate linked moiety X)-type motif 2; nudix motif 2; nudix hydrolase 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccttgagagcatgtggcttgatcatcttccgaagatgcctcattcccaaagtggacaacaatgcaattgagtttttactgctgcaggcatcagatggcattcatcactggactcctcccaaaggccatgtggaaccaggagaggatgacttggaaacagccctgagggagacccaagaggaagcaggcatagaagcaggccagctgaccattattgaggggttcaaaagggaactcaattatgtggccaggaacaagcctaaaacagtcatttactggctggcggaggtgaaggactatgacgtggagatccgcctctcccatgagcaccaagcctaccgctggctggggctggaggaggcctgccagttggctcagttcaaggagatgaaggcagcgctccaagaaggacaccagtttctttgctccatagaggcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - v-rel reticuloendotheliosis viral oncogene homolog A (avian)
- interferon-induced protein with tetratricopeptide repeats 3
- protein kinase C and casein kinase substrate in neurons 2
- carcinoembryonic antigen-related cell adhesion molecule 5

Buy NUDT2-nudix (nucleoside diphosphate linked moiety X)-type motif 2 Gene now

Add to cart