Cart 5 Product Products 894,47 € (empty)
-
1 x GCET2-germ...113,40 € -
-
1 x RARRES3-re...113,40 € -
-
No products
To be determined Shipping
894,47 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 5 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 894,47 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 894,47 €
View larger 
RELA-v-rel reticuloendotheliosis viral oncogene homolog A (avian) Gene
PTXBC011603
New product
Data sheet of RELA-v-rel reticuloendotheliosis viral oncogene homolog A (avian) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RELA-v-rel reticuloendotheliosis viral oncogene homolog A (avian) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC011603 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RELA |
| Origin species: | Human |
| Product name: | RELA-v-rel reticuloendotheliosis viral oncogene homolog A (avian) Gene |
| Size: | 2ug |
| Accessions: | BC011603 |
| Gene id: | 5970 |
| Gene description: | v-rel reticuloendotheliosis viral oncogene homolog A (avian) |
| Synonyms: | RELA proto-oncogene, NF-kB subunit; NFKB3; transcription factor p65; NF-kappa-B p65delta3; NF-kappa-B transcription factor p65; nuclear factor NF-kappa-B p65 subunit; nuclear factor of kappa light polypeptide gene enhancer in B-cells 3; v-rel avian reticuloendotheliosis viral oncogene homolog A; v-rel reticuloendotheliosis viral oncogene homolog A |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggacgaactgttccccctcatcttcccggcagagccagcccaggcctctggcccctatgtggagatcattgagcagcccaagcagcggggcatgcgcttccgctacaagtgcgaggggcgctccgcgggcagcatcccaggcgagaggagcacagataccaccaagacccaccccaccatcaagatcaatggctacacaggaccagggacagtgcgcatctccctggtcaccaaggaccctcctcaccggcctcacccccacgagcttgtaggaaaggactgccgggatggcttctatgaggctgagctctgcccggaccgctgcatccacagtttccagaacctgggaatccagtgtgtgaagaagcgggacctggagcaggctatcagtcagcgcatccagaccaacaacaaccccttccaagttcctatagaagagcagcgtggggactacgacctgaatgctgtgcggctctgcttccaggtgacagtgcgggacccatcaggcaggcccctccgcctgccgcctgtcctttctcatcccatctttgacaatcgtgcccccaacactgccgagctcaagatctgccgagtgaaccgaaactctggcagctgcctcggtggggatgagatcttcctactgtgtgacaaggtgcagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - interferon-induced protein with tetratricopeptide repeats 3 - protein kinase C and casein kinase substrate in neurons 2 - carcinoembryonic antigen-related cell adhesion molecule 5 - oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide) |