Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
YWHAB-tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide Gene
PTXBC010352
New product
Data sheet of YWHAB-tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about YWHAB-tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC010352 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | YWHAB |
| Origin species: | Human |
| Product name: | YWHAB-tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide Gene |
| Size: | 2ug |
| Accessions: | BC010352 |
| Gene id: | 7529 |
| Gene description: | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide |
| Synonyms: | GW128; HEL-S-1; HS1; KCIP-1; YWHAA; 14-3-3 protein beta/alpha; 14-3-3 alpha; brain protein 14-3-3, beta isoform; epididymis secretory protein Li 1; protein 1054; protein kinase C inhibitor protein-1; tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, alpha polypeptide; tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide; tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaatgaccttatctgtttcctggataatacctttaagaataatgtcctgagtcaggcgtggtggtgcgtgcatctagtcccaactatttgggaggctgaggcaggaggatcgcttgagcccaggagtttaaagctgcagtgccctgtggttgcacctgtgaataactgcactccagcctgggcaacatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 2 - solute carrier family 35 (UDP-N-acetylglucosamine (UDP-GlcNAc) transporter), member A3 - tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide - DMC1 dosage suppressor of mck1 homolog, meiosis-specific homologous recombination (yeast) |