Login to display prices
Login to display prices
LILRB1-leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 1 Gene View larger

LILRB1-leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 1 Gene

PTXBC015731

New product

Data sheet of LILRB1-leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about LILRB1-leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 1 Gene

Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC015731
Ncbi symbol: LILRB1
Product name: LILRB1-leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 1 Gene
Size: 2ug
Accessions: BC015731
Gene id: 10859
Gene description: leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 1
Synonyms: CD85J; ILT-2; ILT2; LIR-1; LIR1; MIR-7; MIR7; PIR-B; PIRB; leukocyte immunoglobulin-like receptor subfamily B member 1; CD85 antigen-like family member J; Ig-like transcript 2; leucocyte Ig-like receptor B1; leukocyte immunoglobulin-like receptor subfamily B member 1 soluble isoform; leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 1; monocyte/macrophage immunoglobulin-like receptor 7; myeloid inhibitory receptor 7; leukocyte immunoglobulin like receptor B1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacccccatcctcacggtcctgatctgtctcgggctgagtctgggcccccggacccacgtgcaggcagggcacctccccaagcccaccctctgggctgaaccaggctctgtgatcacccaggggagtcctgtgaccctcaggtgtcaggggggccaggagacccaggagtaccgtctatatagagaaaagaaaacagcaccctggattacacggatcccacaggagcttgtgaagaagggccagttccccatcccatccatcacctgggaacatgcagggcggtatcgctgttactatggtagcgacactgcaggccgctcagagagcagtgaccccctggagctggtggtgacaggagcctacatcaaacccaccctctcagcccagcccagccccgtggtgaactcaggagggaatgtaaccctccagtgtgactcacaggtggcatttgatggcttcattctgtgtaaggaaggagaagatgaacacccacaatgcctgaactcccagccccatgcccgtgggtcgtcccgcgccatcttctccgtgggccccgtgagcccgagtcgcaggtggtggtacaggtgctatgcttatgactcgaactctccctatgagtggtctctacccagtgatctcctggagctcctggtcctaggtgtttctaagaagccatcactctcagtgcagccaggtcctatcgtggcccctgaggagaccctgactctgcagtgtggctctgatgctggctacaacagatttgttctgtataaggacggggaacgtgacttccttcagctcgctggcgcacagccccaggctgggctctcccaggccaacttcaccctgggccctgtgagccgctcctacgggggccagtacagatgctacggtgcacacaacctctcctccgagtggtcggcccccagcgaccccctggacatcctgatcgcaggacagttctatgacagagtctccctctcggtgcagccgggccccacggtggcctcaggagagaacgtgaccctgctgtgtcagtcacagggatggatgcaaactttccttctgaccaaggagggggcagctgatgacccatggcgtctaagatcaacgtaccaatctcaaaaataccaggctgaattccccatgggtcctgtgacctcagcccatgcggggacctacaggtgctacggctcacagagctccaaaccctacctgctgactcaccccagtgaccccctggagctcgtggtctcaggaccgtctgggggccccagctccccgacaacaggccccacctccacatctggccctgaggaccagcccctcacccccaccgggtcggatccccagagtggtctgggaaggcacctgggggttgtgatcggcatcttggtggccgtcatcctactgctcctcctcctcctcctcctcttcctcatcctccgacatcgacgtcagggcaaacactggacatcgacccagagaaaggctgatttccaacatcctgcaggggctgtggggccagagcccacagacagaggcctgcagtggaggtccagcccagctgccgatgcccaggaagaaaacctctatgctgccgtgaagcacacacagcctgaggatggggtggagatggacactcggagcccacacgatgaagacccccaggcagtgacgtatgccgaggtgaaacactccagacctaggagagaaatggcctctcctccttccccactgtctggggaattcctggacacaaaggacagacaggcggaagaggacaggcagatggacactgaggctgctgcatctgaagccccccaggatgtgacctacgcccagctgcacagcttgacccttagacggaaggcaactgagcctcctccatcccaggaagggccctctccagctgtgcccagcatctacgccactctggccatccactag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: