Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
KCNN4-potassium intermediate/small conductance calcium-activated channel, subfamily N, member 4 Gene
PTXBC015337
New product
Data sheet of KCNN4-potassium intermediate/small conductance calcium-activated channel, subfamily N, member 4 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about KCNN4-potassium intermediate/small conductance calcium-activated channel, subfamily N, member 4 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC015337 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | KCNN4 |
| Origin species: | Human |
| Product name: | KCNN4-potassium intermediate/small conductance calcium-activated channel, subfamily N, member 4 Gene |
| Size: | 2ug |
| Accessions: | BC015337 |
| Gene id: | 3783 |
| Gene description: | potassium intermediate/small conductance calcium-activated channel, subfamily N, member 4 |
| Synonyms: | DHS2; IK1; IKCA1; KCA4; KCa3.1; SK4; hIKCa1; hKCa4; hSK4; intermediate conductance calcium-activated potassium channel protein 4; SKCa 4; SKCa4; potassium channel, calcium activated intermediate/small conductance subfamily N alpha, member 4; potassium intermediate/small conductance calcium-activated channel, subfamily N, member 4; small conductance calcium-activated potassium channel 4; potassium calcium-activated channel subfamily N member 4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggcggggatctggtgcttggcctgggggccttgagacgccgaaagcgcttgctggagcaggagaagtctctggccggctgggcactggtgctggcaggaactggcattggactcatggtgctgcatgcagagatgctgtggttcggggggtgctcgtgggcgctctacctgttcctggttaaatgcacgatcagcatttccaccttcttactcctctgcctcatcgtggcctttcatgccaaagaggtccagctgttcatgaccgacaacgggctgcgggactggcgcgtggcgctgaccgggcggcaggcggcgcagatcgtgctggagctggtggtgtgtgggctgcacccggcgcccgtgcggggcccgccgtgcgtgcaggatttaggggcgccgctgacctccccgcagccctggccgggattcctgggccaaggggaagcgctgctgtccctggccatgctgctgcgtctctacctggtgccccgcgccgtgctcctgcgcagcggcgtcctgctcaacgcttcctaccgcagcatcggcgctctcaatcaagtccgcttccgccactggttcgtggccaagctttacatgaacacgcaccctggccgcctgctgctcggcctcacgcttggcctctggctgaccaccgcctgggtgctgtccgtggccgagaggcaggctgttaatgccactgggcacctttcagacacactttggctgatccccatcacattcctgaccatcggctatggtgacgtggtgccgggcaccatgtggggcaagatcgtctgcctgtgcactggagtcatgggtgtctgctgcacagccctgctggtggccgtggtggcccggaagctggagtttaacaaggcagagaagcacgtgcacaacttcatgatggatatccagtataccaaagagatgaaggagtccgctgcccgagtgctacaagaagcctggatgttctacaaacatactcgcaggaaggagtctcatgctgcccgcaggcatcagcgcaagctgctggccgccatcaacgcgttccgccaggtgcggctgaaacaccggaagctccgggaacaagtgaactccatggtggacatctccaagatgcacatgatcctgtatgacctgcagcagaatctgagcagctcacaccgggccctggagaaacagattgacacgctggcggggaagctggatgccctgactgagctgcttagcactgccctggggccgaggcagcttccagaacccagccagcagtccaagtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 5 - leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 4 - leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 5 - leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 1 |