KCNN4-potassium intermediate/small conductance calcium-activated channel, subfamily N, member 4 Gene View larger

KCNN4-potassium intermediate/small conductance calcium-activated channel, subfamily N, member 4 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of KCNN4-potassium intermediate/small conductance calcium-activated channel, subfamily N, member 4 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about KCNN4-potassium intermediate/small conductance calcium-activated channel, subfamily N, member 4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015337
Product type: DNA & cDNA
Ncbi symbol: KCNN4
Origin species: Human
Product name: KCNN4-potassium intermediate/small conductance calcium-activated channel, subfamily N, member 4 Gene
Size: 2ug
Accessions: BC015337
Gene id: 3783
Gene description: potassium intermediate/small conductance calcium-activated channel, subfamily N, member 4
Synonyms: DHS2; IK1; IKCA1; KCA4; KCa3.1; SK4; hIKCa1; hKCa4; hSK4; intermediate conductance calcium-activated potassium channel protein 4; SKCa 4; SKCa4; potassium channel, calcium activated intermediate/small conductance subfamily N alpha, member 4; potassium intermediate/small conductance calcium-activated channel, subfamily N, member 4; small conductance calcium-activated potassium channel 4; potassium calcium-activated channel subfamily N member 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggcggggatctggtgcttggcctgggggccttgagacgccgaaagcgcttgctggagcaggagaagtctctggccggctgggcactggtgctggcaggaactggcattggactcatggtgctgcatgcagagatgctgtggttcggggggtgctcgtgggcgctctacctgttcctggttaaatgcacgatcagcatttccaccttcttactcctctgcctcatcgtggcctttcatgccaaagaggtccagctgttcatgaccgacaacgggctgcgggactggcgcgtggcgctgaccgggcggcaggcggcgcagatcgtgctggagctggtggtgtgtgggctgcacccggcgcccgtgcggggcccgccgtgcgtgcaggatttaggggcgccgctgacctccccgcagccctggccgggattcctgggccaaggggaagcgctgctgtccctggccatgctgctgcgtctctacctggtgccccgcgccgtgctcctgcgcagcggcgtcctgctcaacgcttcctaccgcagcatcggcgctctcaatcaagtccgcttccgccactggttcgtggccaagctttacatgaacacgcaccctggccgcctgctgctcggcctcacgcttggcctctggctgaccaccgcctgggtgctgtccgtggccgagaggcaggctgttaatgccactgggcacctttcagacacactttggctgatccccatcacattcctgaccatcggctatggtgacgtggtgccgggcaccatgtggggcaagatcgtctgcctgtgcactggagtcatgggtgtctgctgcacagccctgctggtggccgtggtggcccggaagctggagtttaacaaggcagagaagcacgtgcacaacttcatgatggatatccagtataccaaagagatgaaggagtccgctgcccgagtgctacaagaagcctggatgttctacaaacatactcgcaggaaggagtctcatgctgcccgcaggcatcagcgcaagctgctggccgccatcaacgcgttccgccaggtgcggctgaaacaccggaagctccgggaacaagtgaactccatggtggacatctccaagatgcacatgatcctgtatgacctgcagcagaatctgagcagctcacaccgggccctggagaaacagattgacacgctggcggggaagctggatgccctgactgagctgcttagcactgccctggggccgaggcagcttccagaacccagccagcagtccaagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 5
- leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 4
- leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 5
- leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 1

Buy KCNN4-potassium intermediate/small conductance calcium-activated channel, subfamily N, member 4 Gene now

Add to cart