Login to display prices
Login to display prices
LILRB4-leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 4 Gene View larger

LILRB4-leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 4 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LILRB4-leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 4 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about LILRB4-leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC026309
Product type: DNA & cDNA
Ncbi symbol: LILRB4
Origin species: Human
Product name: LILRB4-leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 4 Gene
Size: 2ug
Accessions: BC026309
Gene id: 11006
Gene description: leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 4
Synonyms: CD85K; ILT-3; ILT3; LIR-5; LIR5; leukocyte immunoglobulin-like receptor subfamily B member 4; CD85 antigen-like family member K; immunoglobulin-like transcript 3; leucocyte Ig-like receptor B4; leukocyte immunoglobulin-like receptor 5; leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 4; monocyte inhibitory receptor HM18; leukocyte immunoglobulin like receptor B4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgatccccaccttcacggctctgctctgcctcgggctgagtctgggccccaggaccgacatgcaggcagggcccctccccaaacccaccctctgggctgagccaggctctgtgatcagctgggggaactctgtgaccatctggtgtcaggggaccctggaggctcgggagtaccgtctggataaagaggaaagcccagcaccctgggacagacagaacccactggagcccaagaacaaggccagattctccatcccatccatgacagaggactatgcagggagataccgctgttactatcgcagccctgtaggctggtcacagcccagtgaccccctggagctggtgatgacaggagcctacagtaaacccaccctttcagccctgccgagtcctcttgtgacctcaggaaagagcgtgaccctgctgtgtcagtcacggagcccaatggacactttccttctgatcaaggagcgggcagcccatcccctactgcatctgagatcagagcacggagctcagcagcaccaggctgaattccccatgagtcctgtgacctcagtgcacggggggacctacaggtgcttcagctcacacggcttctcccactacctgctgtcacaccccagtgaccccctggagctcatagtctcaggatccttggagggtcccaggccctcacccacaaggtccgtctcaacagctgcaggccctgaggaccagcccctcatgcctacagggtcagtcccccacagtggtctgagaaggcactgggaggtactgatcggggtcttggtggtctccatcctgcttctctccctcctcctcttcctcctcctccaacactggcgtcagggaaaacacaggacattggcccagagacaggctgatttccaacgtcctccaggggctgccgagccagagcccaaggacgggggcctacagaggaggtccagcccagctgctgacgtccagggagaaaacttctgtgctgccgtgaagaacacacagcctgaggacggggtggaaatggacactcggcagagcccacacgatgaagacccccaggcagtgacgtatgccaaggtgaaacactccagacctaggagagaaatggcctctcctccctccccactgtctggggaattcctggacacaaaggacagacaggcagaagaggacagacagatggacactgaggctgctgcatctgaagccccccaggatgtgacctacgcccggctgcacagctttaccctcagacagaaggcaactgagcctcctccatcccaggaaggggcctctccagctgagcccagtgtctatgccactctggccatccactaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 5
- leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 1
- aldo-keto reductase family 1, member C3 (3-alpha hydroxysteroid dehydrogenase, type II)
- tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide