Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
LILRB4-leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 4 Gene
PTXBC026309
New product
Data sheet of LILRB4-leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 4 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about LILRB4-leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 4 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC026309 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LILRB4 |
| Origin species: | Human |
| Product name: | LILRB4-leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 4 Gene |
| Size: | 2ug |
| Accessions: | BC026309 |
| Gene id: | 11006 |
| Gene description: | leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 4 |
| Synonyms: | CD85K; ILT-3; ILT3; LIR-5; LIR5; leukocyte immunoglobulin-like receptor subfamily B member 4; CD85 antigen-like family member K; immunoglobulin-like transcript 3; leucocyte Ig-like receptor B4; leukocyte immunoglobulin-like receptor 5; leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 4; monocyte inhibitory receptor HM18; leukocyte immunoglobulin like receptor B4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgatccccaccttcacggctctgctctgcctcgggctgagtctgggccccaggaccgacatgcaggcagggcccctccccaaacccaccctctgggctgagccaggctctgtgatcagctgggggaactctgtgaccatctggtgtcaggggaccctggaggctcgggagtaccgtctggataaagaggaaagcccagcaccctgggacagacagaacccactggagcccaagaacaaggccagattctccatcccatccatgacagaggactatgcagggagataccgctgttactatcgcagccctgtaggctggtcacagcccagtgaccccctggagctggtgatgacaggagcctacagtaaacccaccctttcagccctgccgagtcctcttgtgacctcaggaaagagcgtgaccctgctgtgtcagtcacggagcccaatggacactttccttctgatcaaggagcgggcagcccatcccctactgcatctgagatcagagcacggagctcagcagcaccaggctgaattccccatgagtcctgtgacctcagtgcacggggggacctacaggtgcttcagctcacacggcttctcccactacctgctgtcacaccccagtgaccccctggagctcatagtctcaggatccttggagggtcccaggccctcacccacaaggtccgtctcaacagctgcaggccctgaggaccagcccctcatgcctacagggtcagtcccccacagtggtctgagaaggcactgggaggtactgatcggggtcttggtggtctccatcctgcttctctccctcctcctcttcctcctcctccaacactggcgtcagggaaaacacaggacattggcccagagacaggctgatttccaacgtcctccaggggctgccgagccagagcccaaggacgggggcctacagaggaggtccagcccagctgctgacgtccagggagaaaacttctgtgctgccgtgaagaacacacagcctgaggacggggtggaaatggacactcggcagagcccacacgatgaagacccccaggcagtgacgtatgccaaggtgaaacactccagacctaggagagaaatggcctctcctccctccccactgtctggggaattcctggacacaaaggacagacaggcagaagaggacagacagatggacactgaggctgctgcatctgaagccccccaggatgtgacctacgcccggctgcacagctttaccctcagacagaaggcaactgagcctcctccatcccaggaaggggcctctccagctgagcccagtgtctatgccactctggccatccactaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 5 - leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 1 - aldo-keto reductase family 1, member C3 (3-alpha hydroxysteroid dehydrogenase, type II) - tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide |