No products
Prices are tax excluded
PTXBC002443
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC002443 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TMED1 |
| Origin species: | Human |
| Product name: | TMED1-transmembrane emp24 protein transport domain containing 1 Gene |
| Size: | 2ug |
| Accessions: | BC002443 |
| Gene id: | 11018 |
| Gene description: | transmembrane emp24 protein transport domain containing 1 |
| Synonyms: | IL1RL1LG; Il1rl1l; Tp24; p24g1; transmembrane emp24 domain-containing protein 1; IL1RL1-binding protein; interleukin 1 receptor-like 1 ligand; p24 family protein gamma-1; transmembrane emp24 protein transport domain containing 1; transmembrane p24 trafficking protein 1 |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgatggcggccggcgcggccctagccctggccttgtggctactaatgccaccagtggaggtgggaggggcggggcccccgccaatccaggacggtgagttcacgttcctgttgccggcggggaggaagcagtgtttctaccagtccgcgccggccaacgcaagcctcgagaccgaataccaggtgatcggaggtgctggactggacgtggacttcacgctggagagccctcagggcgtgctgttggtcagcgagtcccgcaaggctgatggggtacacacggtggagccaacggaggccggggactacaagctgtgctttgacaactccttcagcaccatctccgagaagctggtgttctttgaactgatctttgacagcctccaggatgacgaggaggtcgaaggatgggcagaggctgtggagcccgaggagatgctggatgttaaaatggaggacatcaaggagtccattgagaccatgcggacccggctggagcgcagcatccagatgctcacgctactgcgggccttcgaggcacgtgaccgcaacctgcaagagggcaacttggagcgggtcaacttctggtcagctgtcaacgtggcggtgctgctgctggtggctgtgctgcaggtctgcacgctcaagcgcttcttccaggacaagcgcccggtgcccacgtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - brain-enriched guanylate kinase-associated homolog (rat) - polymerase (RNA) III (DNA directed) polypeptide E (80kD) - PRP3 pre-mRNA processing factor 3 homolog (S. cerevisiae) - signal transducer and activator of transcription 1, 91kDa |