TMED1-transmembrane emp24 protein transport domain containing 1 Gene View larger

TMED1-transmembrane emp24 protein transport domain containing 1 Gene

PTXBC002443

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TMED1-transmembrane emp24 protein transport domain containing 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TMED1-transmembrane emp24 protein transport domain containing 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002443
Product type: DNA & cDNA
Ncbi symbol: TMED1
Origin species: Human
Product name: TMED1-transmembrane emp24 protein transport domain containing 1 Gene
Size: 2ug
Accessions: BC002443
Gene id: 11018
Gene description: transmembrane emp24 protein transport domain containing 1
Synonyms: IL1RL1LG; Il1rl1l; Tp24; p24g1; transmembrane emp24 domain-containing protein 1; IL1RL1-binding protein; interleukin 1 receptor-like 1 ligand; p24 family protein gamma-1; transmembrane emp24 protein transport domain containing 1; transmembrane p24 trafficking protein 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgatggcggccggcgcggccctagccctggccttgtggctactaatgccaccagtggaggtgggaggggcggggcccccgccaatccaggacggtgagttcacgttcctgttgccggcggggaggaagcagtgtttctaccagtccgcgccggccaacgcaagcctcgagaccgaataccaggtgatcggaggtgctggactggacgtggacttcacgctggagagccctcagggcgtgctgttggtcagcgagtcccgcaaggctgatggggtacacacggtggagccaacggaggccggggactacaagctgtgctttgacaactccttcagcaccatctccgagaagctggtgttctttgaactgatctttgacagcctccaggatgacgaggaggtcgaaggatgggcagaggctgtggagcccgaggagatgctggatgttaaaatggaggacatcaaggagtccattgagaccatgcggacccggctggagcgcagcatccagatgctcacgctactgcgggccttcgaggcacgtgaccgcaacctgcaagagggcaacttggagcgggtcaacttctggtcagctgtcaacgtggcggtgctgctgctggtggctgtgctgcaggtctgcacgctcaagcgcttcttccaggacaagcgcccggtgcccacgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - brain-enriched guanylate kinase-associated homolog (rat)
- polymerase (RNA) III (DNA directed) polypeptide E (80kD)
- PRP3 pre-mRNA processing factor 3 homolog (S. cerevisiae)
- signal transducer and activator of transcription 1, 91kDa

Buy TMED1-transmembrane emp24 protein transport domain containing 1 Gene now

Add to cart