POLR3E-polymerase (RNA) III (DNA directed) polypeptide E (80kD) Gene View larger

POLR3E-polymerase (RNA) III (DNA directed) polypeptide E (80kD) Gene


New product

Data sheet of POLR3E-polymerase (RNA) III (DNA directed) polypeptide E (80kD) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about POLR3E-polymerase (RNA) III (DNA directed) polypeptide E (80kD) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000285
Product type: DNA & cDNA
Ncbi symbol: POLR3E
Origin species: Human
Product name: POLR3E-polymerase (RNA) III (DNA directed) polypeptide E (80kD) Gene
Size: 2ug
Accessions: BC000285
Gene id: 55718
Gene description: polymerase (RNA) III (DNA directed) polypeptide E (80kD)
Synonyms: RPC5; SIN; DNA-directed RNA polymerase III subunit RPC5; DNA-directed RNA polymerase III 80 kDa polypeptide; RNA polymerase III 80 kDa subunit RPC5; RNA polymerase III subunit C5; polymerase (RNA) III (DNA directed) polypeptide E (80kD); polymerase (RNA) III subunit E; RNA polymerase III subunit E
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccaatgaagaggatgacccagttgtacaggagatcgatgtgtacttggccaagagtctggcggaaaagctgtatctatttcagtaccctgtgcgtccagcctcgatgacctacgatgacattccgcacctctcagccaagatcaagcccaagcagcagaaggtagagcttgagatggccatcgacaccctgaaccccaactattgccgcagcaaaggggagcagattgcgctgaacgtggacggggcctgcgccgacgagaccagcacgtattcctcgaagctgatggacaagcagaccttctgctcttcccagaccaccagtaacacatcccgttatgccgctgcactctacaggcaaggtgagctccacctgacacctttacatggcatcctgcagctgcggcccagcttctcctacctggataaggctgacgccaagcaccgggagagggaggcggccaacgaggcaggggactcttcacaggatgaggcggaagacgatgttaagcagatcacggtgcggttctcccggccggagtcagagcaggcccgccagcgccgtgtgcagtcctatgagttcctgcagaagaagcacgcagaggagccctgggtccacctgcattactatggcctgagggacagtcgctctgagcatgagcgtcagtacctgctgtgccccggctcaagcggggtggagaacacggagctcgtcaagtcacccagtgagtacctgatgatgctgatgccacccagccaggaggaggagaaagacaagcctgtggcccccagcaacgtcctgtcgatggcccagctgcgcacgctgcccctggccgatcagatcaagatcctgatgaagaatgtgaaggtcatgccttttgccaacttgatgagcctcctgggcccctccatcgattccgtggctgttctgcggggcatccagaaggtggcgatgttggtccaagggaactgggtggtgaagagtgacatcctataccccaaggactcgtccagccctcacagcggcgtgcctgctgaggtgctctgcaggggccgagacttcgttatgtggaagttcacgcagagccgctgggtggttaggaaagaggtggcaaccgtgaccaaactctgcgccgaggatgtgaaggacttcctggagcacatggccgtggtgaggatcaacaaaggctgggagttcattctgccttatgatggggagttcatcaagaagcacccggatgtggtccagcggcagcacatgctgtggacgggtatccaggccaaactggaaaaagtctataatcttgtaaaggaaaccatgccaaagaagccggatgcacaatcagggcctgccgggctggtctgtggggaccagcggatccaagtagccaaaaccaaggcccagcagaaccacgcgttgctggagcgggagctgcagcggcggaaggagcagctgcgggtgcctgcggtcccgcccggtgtgcggatcaaggaggagcccgtgagcgaggagggcgaggaggacgaggagcaggaggcggaggaggagcccatggacacttcccccagcggcctccacagcaagctggccaacgggctgcctctcgggcgggctgcgggcacagacagcttcaacgggcacccgccccagggctgcgccagcacccctgtggctcgggaactgaaggccttcgtggaggccacctttcagagacagtttgtgctcacgctgagcgaactcaagcgcctcttcaatctgcacttggccagcctgccccccggccacacactcttcagcggcatctcggaccgcatgctacaggacacggtgctggccgccggttgcaagcagatactggtgccttttcccccccagactgctgcttccccggatgagcagaaggtgtttgccctctgggagtctggagacatgagtgatcaggactgctgtgtaagctatggtggcatgtggtaccttaaagggacagtacagtcttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - PRP3 pre-mRNA processing factor 3 homolog (S. cerevisiae)
- signal transducer and activator of transcription 1, 91kDa
- N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 2
- retinoic acid receptor responder (tazarotene induced) 2

Buy POLR3E-polymerase (RNA) III (DNA directed) polypeptide E (80kD) Gene now

Add to cart