BAD-BCL2-associated agonist of cell death Gene View larger

BAD-BCL2-associated agonist of cell death Gene

PTXBC001901

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of BAD-BCL2-associated agonist of cell death Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about BAD-BCL2-associated agonist of cell death Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001901
Product type: DNA & cDNA
Ncbi symbol: BAD
Origin species: Human
Product name: BAD-BCL2-associated agonist of cell death Gene
Size: 2ug
Accessions: BC001901
Gene id: 572
Gene description: BCL2-associated agonist of cell death
Synonyms: BBC2; BCL2L8; bcl2-associated agonist of cell death; BCL-X/BCL-2 binding protein; BCL2-antagonist of cell death protein; BCL2-binding component 6; BCL2-binding protein; bcl-2-binding component 6; bcl-2-like protein 8; bcl-XL/Bcl-2-associated death promoter; bcl2 antagonist of cell death; bcl2-L-8; BCL2 associated agonist of cell death
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagaggggcctgggccccagccccgcaggggacgggccctcaggctccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagcagccaaccagcagcagccatcatggaggcgctggggctgtggagatccggagtcgccacagctcctaccccgcggggacggaggacgacgaagggatgggggaggagcccagcccctttcggggccgctcgcgctcggcgccccccaacctctgggcagcacagcgctatggccgcgagctccggaggatgagtgacgagtttgtggactcctttaagaagggacttcctcgcccgaagagcgcgggcacagcaacgcagatgcggcaaagctccagctggacgcgagtcttccagtcctggtgggatcggaacttgggcaggggaagctccgccccctcccagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - keratin associated protein 4-12
- nuclear transcription factor Y, beta
- RAB27B, member RAS oncogene family
- coiled-coil domain containing 90B

Buy BAD-BCL2-associated agonist of cell death Gene now

Add to cart