PTXBC001901
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001901 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | BAD |
| Origin species: | Human |
| Product name: | BAD-BCL2-associated agonist of cell death Gene |
| Size: | 2ug |
| Accessions: | BC001901 |
| Gene id: | 572 |
| Gene description: | BCL2-associated agonist of cell death |
| Synonyms: | BBC2; BCL2L8; bcl2-associated agonist of cell death; BCL-X/BCL-2 binding protein; BCL2-antagonist of cell death protein; BCL2-binding component 6; BCL2-binding protein; bcl-2-binding component 6; bcl-2-like protein 8; bcl-XL/Bcl-2-associated death promoter; bcl2 antagonist of cell death; bcl2-L-8; BCL2 associated agonist of cell death |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagaggggcctgggccccagccccgcaggggacgggccctcaggctccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagcagccaaccagcagcagccatcatggaggcgctggggctgtggagatccggagtcgccacagctcctaccccgcggggacggaggacgacgaagggatgggggaggagcccagcccctttcggggccgctcgcgctcggcgccccccaacctctgggcagcacagcgctatggccgcgagctccggaggatgagtgacgagtttgtggactcctttaagaagggacttcctcgcccgaagagcgcgggcacagcaacgcagatgcggcaaagctccagctggacgcgagtcttccagtcctggtgggatcggaacttgggcaggggaagctccgccccctcccagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - keratin associated protein 4-12 - nuclear transcription factor Y, beta - RAB27B, member RAS oncogene family - coiled-coil domain containing 90B |