Login to display prices
Login to display prices
NFYB-nuclear transcription factor Y, beta Gene View larger

NFYB-nuclear transcription factor Y, beta Gene

PTXBC007035

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NFYB-nuclear transcription factor Y, beta Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about NFYB-nuclear transcription factor Y, beta Gene

Proteogenix catalog: PTXBC007035
Ncbi symbol: NFYB
Product name: NFYB-nuclear transcription factor Y, beta Gene
Size: 2ug
Accessions: BC007035
Gene id: 4801
Gene description: nuclear transcription factor Y, beta
Synonyms: CBF-A; CBF-B; HAP3; NF-YB; nuclear transcription factor Y subunit beta; CAAT box DNA-binding protein subunit B; CCAAT-binding transcription factor subunit A; Transcription factor NF-Y, B subunit; nuclear transcription factor Y subunit B; nuclear transcription factor Y, beta
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacaatggatggtgacagttctacaacagatgcttctcaactaggaatctctgcagactatattggaggaagtcattatgttatgcagcctcatgatgatactgaggacagcatgaatgatcatgaagacacaaatggttcaaaagaaagtttcagagaacaagatatatatcttccaatagcaaacgtggctaggataatgaaaaatgccatacctcaaacgggaaagattgcaaaagatgccaaagaatgtgttcaagaatgtgtaagtgagttcatcagttttataacatctgaagcaagtgaaaggtgccatcaagagaaacggaaaacaatcaatggagaagatattctctttgctatgtctactttaggctttgacagttatgtggaacctctgaaattataccttcagaaattcagagaggctatgaaaggagaaaagggaattggtggagcagtcacagctacagatggactaagtgaagagcttacagaggaggcatttactaaccagttaccagctggcttaataaccacagacggtcaacaacaaaatgttatggtttacacaacatcatatcaacagatttctggtgttcagcaaattcagttttcatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: