NFYB-nuclear transcription factor Y, beta Gene View larger

NFYB-nuclear transcription factor Y, beta Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NFYB-nuclear transcription factor Y, beta Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about NFYB-nuclear transcription factor Y, beta Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007035
Product type: DNA & cDNA
Ncbi symbol: NFYB
Origin species: Human
Product name: NFYB-nuclear transcription factor Y, beta Gene
Size: 2ug
Accessions: BC007035
Gene id: 4801
Gene description: nuclear transcription factor Y, beta
Synonyms: CBF-A; CBF-B; HAP3; NF-YB; nuclear transcription factor Y subunit beta; CAAT box DNA-binding protein subunit B; CCAAT-binding transcription factor subunit A; Transcription factor NF-Y, B subunit; nuclear transcription factor Y subunit B; nuclear transcription factor Y, beta
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacaatggatggtgacagttctacaacagatgcttctcaactaggaatctctgcagactatattggaggaagtcattatgttatgcagcctcatgatgatactgaggacagcatgaatgatcatgaagacacaaatggttcaaaagaaagtttcagagaacaagatatatatcttccaatagcaaacgtggctaggataatgaaaaatgccatacctcaaacgggaaagattgcaaaagatgccaaagaatgtgttcaagaatgtgtaagtgagttcatcagttttataacatctgaagcaagtgaaaggtgccatcaagagaaacggaaaacaatcaatggagaagatattctctttgctatgtctactttaggctttgacagttatgtggaacctctgaaattataccttcagaaattcagagaggctatgaaaggagaaaagggaattggtggagcagtcacagctacagatggactaagtgaagagcttacagaggaggcatttactaaccagttaccagctggcttaataaccacagacggtcaacaacaaaatgttatggtttacacaacatcatatcaacagatttctggtgttcagcaaattcagttttcatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - RAB27B, member RAS oncogene family
- coiled-coil domain containing 90B
- hematopoietically expressed homeobox
- T cell receptor beta variable 5-4

Buy NFYB-nuclear transcription factor Y, beta Gene now

Add to cart