Cart 50 Product Products 11 472,25 € (empty)
-
1 x PSMA3-prot...113,40 € -
1 x N6AMT2-N-6...113,40 € -
1 x GPER-G...121,50 € -
-
-
1 x EPHA7-EPH...121,50 € -
1 x NXT1-NTF2-...113,40 € -
1 x ZNF695-zin...113,40 € -
-
1 x TBC1D7-TBC...121,50 € -
1 x PI4KAP1-ph...113,40 € -
-
-
-
-
1 x JUNB-jun B...121,50 € -
1 x BCAT2-bran...121,50 € -
1 x MRPS22-mit...121,50 € -
1 x AFTPH-afti...113,40 € -
1 x METT5D1-me...113,40 € -
1 x WDR13-WD...121,50 € -
1 x RAB30-RAB3...113,40 € -
1 x PRKAR1A-pr...121,50 € -
-
-
-
1 x C7orf61-ch...113,40 € -
1 x VASH1-vaso...121,50 € -
1 x OR10H1-olf...121,50 € -
1 x RWDD4A-RWD...113,40 € -
1 x Donkey...4 799,76 € -
-
1 x BCL2L14-BC...121,50 € -
1 x OSM-oncost...113,40 € -
1 x DHDDS-dehy...121,50 € -
-
-
1 x B4GALT3-UD...121,50 € -
1 x C12orf23-c...113,40 € -
1 x MSR1-macro...121,50 € -
1 x SHE-Src...121,50 € -
1 x MGLL-monog...121,50 € -
1 x TPMT-thiop...113,40 € -
-
1 x SLC39A7-so...121,50 € -
1 x EEF1G-euka...121,50 € -
1 x RBMS3-RNA...121,50 € -
1 x AUP1-ancie...121,50 € -
-
No products
To be determined Shipping
11 472,25 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 50 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 11 472,25 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 11 472,25 €
Data sheet of HHEX-hematopoietically expressed homeobox Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HHEX-hematopoietically expressed homeobox Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC014336 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HHEX |
| Origin species: | Human |
| Product name: | HHEX-hematopoietically expressed homeobox Gene |
| Size: | 2ug |
| Accessions: | BC014336 |
| Gene id: | 3087 |
| Gene description: | hematopoietically expressed homeobox |
| Synonyms: | hematopoietically-expressed homeobox protein HHEX; HEX; HMPH; HOX11L-PEN; PRH; PRHX; homeobox protein HEX; homeobox protein PRH; homeobox, hematopoietically expressed; proline-rich homeodomain-containing transcription factor; hematopoietically expressed homeobox |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcagtacccgcaccccgggccggcggcgggcgccgtgggggtgccgctgtacgcgcccacgccgctgctgcaacccgcacacccgacgcccttttacatcgaggacatcctgggccgcgggcccgccgcgcccacgcccgcccccacgctgccgtcccccaactcctccttcaccagcctcgtgtccccctaccggaccccggtgtacgagcccacgccgatccatccagccttctcgcaccactccgccgccgcgctggccgctgcctacggacccggcggcttcgggggccctctgtaccccttcccgcggacggtgaacgactacacgcacgccctgctccgccacgaccccctgggcaaacctctactctggagccccttcttgcagaggcctctgcataaaaggaaaggcggccaggtgagattctccaacgaccagaccatcgagctggagaagaaattcgagacgcagaaatatctctctccgcccgagaggaagcgtctgaccaagatgctgcagctcagcgagagacaggtcaaaacctggtttcagaatcgacgcgctaaatggaggagactaaaacaggagaaccctcaaagcaataaaaaagaagaactggaaagtttggacagttcctgtgatcagaggcaagatttgcccagtgaacagaataaaggtgcttctttggatagctctcaatgttcgccctcccctgcctcccaggaagaccttgaatcagagatttcagaggattctgatcaggaagtggacattgagggcgataaaagctattttaatgctggatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - T cell receptor beta variable 5-4 - naked cuticle homolog 2 (Drosophila) - sorbin and SH3 domain containing 3 - hydroxysteroid dehydrogenase like 1 |