HHEX-hematopoietically expressed homeobox Gene View larger

HHEX-hematopoietically expressed homeobox Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HHEX-hematopoietically expressed homeobox Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about HHEX-hematopoietically expressed homeobox Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014336
Product type: DNA & cDNA
Ncbi symbol: HHEX
Origin species: Human
Product name: HHEX-hematopoietically expressed homeobox Gene
Size: 2ug
Accessions: BC014336
Gene id: 3087
Gene description: hematopoietically expressed homeobox
Synonyms: hematopoietically-expressed homeobox protein HHEX; HEX; HMPH; HOX11L-PEN; PRH; PRHX; homeobox protein HEX; homeobox protein PRH; homeobox, hematopoietically expressed; proline-rich homeodomain-containing transcription factor; hematopoietically expressed homeobox
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcagtacccgcaccccgggccggcggcgggcgccgtgggggtgccgctgtacgcgcccacgccgctgctgcaacccgcacacccgacgcccttttacatcgaggacatcctgggccgcgggcccgccgcgcccacgcccgcccccacgctgccgtcccccaactcctccttcaccagcctcgtgtccccctaccggaccccggtgtacgagcccacgccgatccatccagccttctcgcaccactccgccgccgcgctggccgctgcctacggacccggcggcttcgggggccctctgtaccccttcccgcggacggtgaacgactacacgcacgccctgctccgccacgaccccctgggcaaacctctactctggagccccttcttgcagaggcctctgcataaaaggaaaggcggccaggtgagattctccaacgaccagaccatcgagctggagaagaaattcgagacgcagaaatatctctctccgcccgagaggaagcgtctgaccaagatgctgcagctcagcgagagacaggtcaaaacctggtttcagaatcgacgcgctaaatggaggagactaaaacaggagaaccctcaaagcaataaaaaagaagaactggaaagtttggacagttcctgtgatcagaggcaagatttgcccagtgaacagaataaaggtgcttctttggatagctctcaatgttcgccctcccctgcctcccaggaagaccttgaatcagagatttcagaggattctgatcaggaagtggacattgagggcgataaaagctattttaatgctggatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - T cell receptor beta variable 5-4
- naked cuticle homolog 2 (Drosophila)
- sorbin and SH3 domain containing 3
- hydroxysteroid dehydrogenase like 1

Buy HHEX-hematopoietically expressed homeobox Gene now

Add to cart