HSDL1-hydroxysteroid dehydrogenase like 1 Gene View larger

HSDL1-hydroxysteroid dehydrogenase like 1 Gene

PTXBC018084

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HSDL1-hydroxysteroid dehydrogenase like 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about HSDL1-hydroxysteroid dehydrogenase like 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC018084
Product type: DNA & cDNA
Ncbi symbol: HSDL1
Origin species: Human
Product name: HSDL1-hydroxysteroid dehydrogenase like 1 Gene
Size: 2ug
Accessions: BC018084
Gene id: 83693
Gene description: hydroxysteroid dehydrogenase like 1
Synonyms: SDR12C3; inactive hydroxysteroid dehydrogenase-like protein 1; short chain dehydrogenase/reductase family 12C member 3; steroid dehydrogenase-like protein; hydroxysteroid dehydrogenase like 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgctgttgacagtttctacctcttgtacagggaaatcgccaggtcttgcaattgctatatggaagctctagctttggttggagcctggtatacggccagaaaaagcatcactgtcatctgtgacttttacagcctgatcaggctgcattttatcccccgcctggggagcagagcagacttgatcaagcagtatggaagatgggccgttgtcagcggtgcaacagatgggattggaaaagcctacgctgaagagttagcaagccgaggtctcaatataatcctgattagtcggaacgaggagaagttgcaggttgttgctaaagacatagccgacacgtacaaagtggaaactgatattatagttgcggacttcagcagcggtcgtgagatctaccttccaattcgagaagccctgaaggacaaagacgttggcatcttggtaaataacgtgggtgtgttttatccctacccgcagtatttcactcagctgtccgaggacaagctctgggacatcataaatgtgaacattgccgccgctagtttgatggtccatgttgtgttaccgggaatggtggagagaaagaaaggtgccatcgtcacgatctcttctggctcctgctgcaaacccactcctcagctggctgcattttctgcttctaaggcttatttagaccacttcagcagagccttgcaatatgaatatgcctctaaaggaatctttgtacagagtctaatccctttctatgtagccgccagcatgacagcacccagcaactttctgcacaggtgctcgtggttggtgccttcgccaaaagtctatgcacatcatgctgtttctactcttgggatttccaaaaggaccacaggatattggtcccattctattcagtttctttttgcacagtatatgcctgaatggctctgggtgtggggagcaaatattctcaaccgttcactacgtaaggaagccttatcctgcacagcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - keratinocyte associated protein 2
- leukocyte cell derived chemotaxin 1
- MAP3K12 binding inhibitory protein 1
- gap junction protein, alpha 5, 40kDa

Buy HSDL1-hydroxysteroid dehydrogenase like 1 Gene now

Add to cart