KRTCAP2-keratinocyte associated protein 2 Gene View larger

KRTCAP2-keratinocyte associated protein 2 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of KRTCAP2-keratinocyte associated protein 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about KRTCAP2-keratinocyte associated protein 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC029806
Product type: DNA & cDNA
Ncbi symbol: KRTCAP2
Origin species: Human
Product name: KRTCAP2-keratinocyte associated protein 2 Gene
Size: 2ug
Accessions: BC029806
Gene id: 200185
Gene description: keratinocyte associated protein 2
Synonyms: KCP2; keratinocyte-associated protein 2; KCP-2; keratinocytes associated protein 2; keratinocyte associated protein 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcgcatagctaaccgcacccggttcagctcgcctttcttggccagaggcgccggttggactcacgggcggggcatgatggtggtgggtacgggcacctcgctggcgctctcctccctcctgtccctgctgctctttgctgggatgcagatgtacagccgtcagctggcctccaccgagtggctcaccatccagggcggcctgcttggttcgggtctcttcgtgttctcgctcactgccttcaataatctggagaatcttgtctttggcaaaggattccaagcaaagatcttccctgagattctcctgtgcctcctgttggctctctttgcatctggcctcatccaccgagtctgtgtcaccacctgcttcatcttctccatggttggtctgtactacatcaacaagatctcctccaccctgtaccaggcagcagctccagtcctcacaccagccaaggtcacaggcaagagcaagaagagaaactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - leukocyte cell derived chemotaxin 1
- MAP3K12 binding inhibitory protein 1
- gap junction protein, alpha 5, 40kDa
- paroxysmal nonkinesigenic dyskinesia

Buy KRTCAP2-keratinocyte associated protein 2 Gene now

Add to cart