GJA5-gap junction protein, alpha 5, 40kDa Gene View larger

GJA5-gap junction protein, alpha 5, 40kDa Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GJA5-gap junction protein, alpha 5, 40kDa Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about GJA5-gap junction protein, alpha 5, 40kDa Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC013313
Product type: DNA & cDNA
Ncbi symbol: GJA5
Origin species: Human
Product name: GJA5-gap junction protein, alpha 5, 40kDa Gene
Size: 2ug
Accessions: BC013313
Gene id: 2702
Gene description: gap junction protein, alpha 5, 40kDa
Synonyms: ATFB11; CX40; gap junction alpha-5 protein; connexin 40; gap junction protein alpha 5 40kDa; gap junction protein alpha 5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggcgattggagcttcctgggaaatttcctggaggaagtacacaagcactcgaccgtggtaggcaaggtctggctcactgtcctcttcatattccgtatgctcgtgctgggcacagctgctgagtcttcctggggggatgagcaggctgatttccggtgtgatacgattcagcctggctgccagaatgtctgctacgaccaggctttccccatctcccacattcgctactgggtgctgcagatcatcttcgtctccacgccctctctggtgtacatgggccacgccatgcacactgtgcgcatgcaggagaagcgcaagctacgggaggccgagagggccaaagaggtccggggctctggctcttacgagtacccggtggcagagaaggcagaactgtcctgctgggaggaagggaatggaaggattgccctccagggcactctgctcaacacctatgtgtgcagcatcctgatccgcaccaccatggaggtgggcttcattgtgggccagtacttcatctacggaatcttcctgaccaccctgcatgtctgccgcaggagtccctgtccccacccggtcaactgttacgtatcccggcccacagagaagaatgtcttcattgtctttatgctggctgtggctgcactgtccctcctccttagcctggctgaactctaccacctgggctggaagaagatcagacagcgatttgtcaaaccgcggcagcacatggctaagtgccagctttctggcccctctgtgggcatagtccagagctgcacaccaccccccgactttaatcagtgcctggagaatggccctgggggaaaattcttcaatcccttcagcaataatatggcctcccaacaaaacacagacaacctggtcaccgagcaagtacgaggtcaggagcagactcctggggaaggtttcatccaggttcgttatggccagaagcctgaggtgcccaatggagtctcaccaggtcaccgccttccccatggctatcatagtgacaagcgacgtcttagtaaggccagcagcaaggcaaggtcagatgacctatcagtgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - paroxysmal nonkinesigenic dyskinesia
- Rho GTPase activating protein 28
- Rho GTPase activating protein 29
- transcobalamin II; macrocytic anemia

Buy GJA5-gap junction protein, alpha 5, 40kDa Gene now

Add to cart