TCN2-transcobalamin II, macrocytic anemia Gene View larger

TCN2-transcobalamin II, macrocytic anemia Gene

PTXBC001176

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TCN2-transcobalamin II, macrocytic anemia Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TCN2-transcobalamin II, macrocytic anemia Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001176
Product type: DNA & cDNA
Ncbi symbol: TCN2
Origin species: Human
Product name: TCN2-transcobalamin II, macrocytic anemia Gene
Size: 2ug
Accessions: BC001176
Gene id: 6948
Gene description: transcobalamin II; macrocytic anemia
Synonyms: D22S676; D22S750; TC II; TC-2; TC2; TCII; transcobalamin-2; macrocytic anemia; transcobalamin II; macrocytic anemia; vitamin B12-binding protein 2; transcobalamin 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaggcaccttggggccttcctcttccttctgggggtcctgggggccctcactgagatgtgtgaaataccagagatggacagccatctggtagagaagttgggccagcacctcttaccttggatggaccggctttccctggagcacttgaaccccagcatctatgtgggcctacgcctctccagtctgcaggctgggaccaaggaagacctctacctgcacagcctcaagcttggttaccagcagtgcctcctagggtctgccttcagcgaggatgacggtgactgccagggcaagccttccatgggccagctggccctctacctgctcgctctcagagccaactgtgagtttgtcaggggccacaagggggacaggctggtctcacagctcaaatggttcctggaggatgagaagagagccattgggcatgatcacaagggccacccccacactagctactaccagtatggcctgggcattctggccctgtgtctccaccagaagcgggtccatgacagcgtggtggacaaacttctgtatgctgtggaacctttccaccagggccaccattctgtggacacagcagccatggcaggcttggcattcacctgtctgaagcgctcaaacttcaaccctggtcggagacaacggatcaccatggccatcagaacagtgcaagaggagatcttgaaggcccagacccccgagggccactttgggaatgtctacagcaccccattggcattacagttcctcatgacttcccccatgcgtggggcagaactgggaacagcatgtctcaaggcgagggttgctttgctggccagtctgcaggatggagccttccagaatgctctcatgatttcccagctgctgcccgttctgaaccacaagacctacattgatctgatcttcccagactgtctggcaccacgagtcatgttggaaccagctgctgagaccattcctcagacccaagagatcatcagtgtcacgctgcaggtgcttagtctcttgccgccgtacagacagtccatctctgttctggccgggtccaccgtggaagatgtcctgaagaaggcccatgagttaggaggattcacatatgaaacacaggcctccttgtcaggcccctacttaacctccgtgatggggaaagcggccggagaaagggagttctggcagcttctccgagaccccaacaccccactgttgcaaggtattgctgactacagacccaaggatggagaaaccattgagctgaggctggttagctggtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - acid phosphatase 6, lysophosphatidic
- coronin, actin binding protein, 1C
- BAI1-associated protein 2-like 1
- coronin, actin binding protein, 2A

Buy TCN2-transcobalamin II, macrocytic anemia Gene now

Add to cart