ACP6-acid phosphatase 6, lysophosphatidic Gene View larger

ACP6-acid phosphatase 6, lysophosphatidic Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ACP6-acid phosphatase 6, lysophosphatidic Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ACP6-acid phosphatase 6, lysophosphatidic Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC034686
Product type: DNA & cDNA
Ncbi symbol: ACP6
Origin species: Human
Product name: ACP6-acid phosphatase 6, lysophosphatidic Gene
Size: 2ug
Accessions: BC034686
Gene id: 51205
Gene description: acid phosphatase 6, lysophosphatidic
Synonyms: ACPL1; LPAP; PACPL1; lysophosphatidic acid phosphatase type 6; acid phosphatase-like protein 1; acid phosphatase 6, lysophosphatidic
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgatcactggtgtgttcagcatgcgcttgtggaccccagtgggcgtcctgacctcgctggcgtactgcctgcaccagcggcgggtggccctggccgagctgcaggaggccgatggccagtgtccggtcgaccgcagcctgctgaagttgaaaatggtgcaggtcgtgtttcgacacggggctcggagtcctctcaagccgctcccgctggaggagcaggtagagtggaacccccagctattagaggtcccaccccaaactcagtttgattacacagtcaccaatctagctggtggtccgaaaccatattctccttacgactctcaataccatgagaccaccctgaaggggggcatgtttgctgggcagctgaccaaggtgggcatgcagcaaatgtttgccttgggagagagactgaggaagaactatgtggaagacattccctttctttcaccaaccttcaacccacaggaggtctttattcgttccactaacatttttcggaatctggagtccacccgttgtttgctggctgggcttttccagtgtcagaaagaaggacccatcatcatccacactgatgaagcagattcagaagtcttgtatcccaactaccaaagctgctggagcctgaggcagagaaccagaggccggaggcagactgcctctttacagccaggaatctcagaggatttgaaaaaggtgaaggacaggatgggcattgacagtagtgataaagtggacttcttcatcctcctggacaacgtggctgccgagcaggcacacaacctcccaagctgccccatgctgaagagatttgcacggatgatcgaacagagagctgtggacacatccttgtacatactgcccaaggaagacagggaaagtcttcagatggcagtaggcccattcctccacatcctagagagcaacctgctgaaagccatggactctgccactgcccccgacaagatcagaaagctgtatctctatgcggctcatgatgtgaccttcataccgctcttaatgaccctggggatttttgaccacaaatggccaccgtttgctgttgacctgaccatggaactttaccagcacctggaatctaaggagtggtttgtgcagctctattaccacggaaaggagcaggtgccgagaggttgccctgatgggctctgcccgctggacatgttcttgaatgccatgtcagtttataccttaagcccagaaaaataccacgcactctgctctcaaactcaggtgatggaagttggaaatgaagagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - coronin, actin binding protein, 1C
- BAI1-associated protein 2-like 1
- coronin, actin binding protein, 2A
- acyl-CoA synthetase family member 2

Buy ACP6-acid phosphatase 6, lysophosphatidic Gene now

Add to cart