Cart 4 Product Products 531,82 € (empty)
-
1 x AMT-aminom...121,50 € -
-
1 x DDIT4L-DNA...113,40 € -
1 x APCS-amylo...113,40 €
No products
To be determined Shipping
531,82 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 4 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 531,82 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 531,82 €
Data sheet of ACP6-acid phosphatase 6, lysophosphatidic Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ACP6-acid phosphatase 6, lysophosphatidic Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC034686 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ACP6 |
| Origin species: | Human |
| Product name: | ACP6-acid phosphatase 6, lysophosphatidic Gene |
| Size: | 2ug |
| Accessions: | BC034686 |
| Gene id: | 51205 |
| Gene description: | acid phosphatase 6, lysophosphatidic |
| Synonyms: | ACPL1; LPAP; PACPL1; lysophosphatidic acid phosphatase type 6; acid phosphatase-like protein 1; acid phosphatase 6, lysophosphatidic |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgatcactggtgtgttcagcatgcgcttgtggaccccagtgggcgtcctgacctcgctggcgtactgcctgcaccagcggcgggtggccctggccgagctgcaggaggccgatggccagtgtccggtcgaccgcagcctgctgaagttgaaaatggtgcaggtcgtgtttcgacacggggctcggagtcctctcaagccgctcccgctggaggagcaggtagagtggaacccccagctattagaggtcccaccccaaactcagtttgattacacagtcaccaatctagctggtggtccgaaaccatattctccttacgactctcaataccatgagaccaccctgaaggggggcatgtttgctgggcagctgaccaaggtgggcatgcagcaaatgtttgccttgggagagagactgaggaagaactatgtggaagacattccctttctttcaccaaccttcaacccacaggaggtctttattcgttccactaacatttttcggaatctggagtccacccgttgtttgctggctgggcttttccagtgtcagaaagaaggacccatcatcatccacactgatgaagcagattcagaagtcttgtatcccaactaccaaagctgctggagcctgaggcagagaaccagaggccggaggcagactgcctctttacagccaggaatctcagaggatttgaaaaaggtgaaggacaggatgggcattgacagtagtgataaagtggacttcttcatcctcctggacaacgtggctgccgagcaggcacacaacctcccaagctgccccatgctgaagagatttgcacggatgatcgaacagagagctgtggacacatccttgtacatactgcccaaggaagacagggaaagtcttcagatggcagtaggcccattcctccacatcctagagagcaacctgctgaaagccatggactctgccactgcccccgacaagatcagaaagctgtatctctatgcggctcatgatgtgaccttcataccgctcttaatgaccctggggatttttgaccacaaatggccaccgtttgctgttgacctgaccatggaactttaccagcacctggaatctaaggagtggtttgtgcagctctattaccacggaaaggagcaggtgccgagaggttgccctgatgggctctgcccgctggacatgttcttgaatgccatgtcagtttataccttaagcccagaaaaataccacgcactctgctctcaaactcaggtgatggaagttggaaatgaagagtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - coronin, actin binding protein, 1C - BAI1-associated protein 2-like 1 - coronin, actin binding protein, 2A - acyl-CoA synthetase family member 2 |