ARHGAP28-Rho GTPase activating protein 28 Gene View larger

ARHGAP28-Rho GTPase activating protein 28 Gene

PTXBC033668

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ARHGAP28-Rho GTPase activating protein 28 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ARHGAP28-Rho GTPase activating protein 28 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC033668
Product type: DNA & cDNA
Ncbi symbol: ARHGAP28
Origin species: Human
Product name: ARHGAP28-Rho GTPase activating protein 28 Gene
Size: 2ug
Accessions: BC033668
Gene id: 79822
Gene description: Rho GTPase activating protein 28
Synonyms: rho GTPase-activating protein 28; rho-type GTPase-activating protein 28; Rho GTPase activating protein 28
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagaaaatccgccatctctctctgattgaattgactgccttttttgatgcctttggaattcaactgaaaaggaacaaaacagagaaagtaaaaggacgagacaatgggatttttggagttccacttacagtcctcctggacggtgaccgaaagaaagaccctggagtgaaagttcccctggtattacaaaaattttttgagaaagttgaggaatcaggtctggaatctgaaggaatttttcgactttcaggatgtactgctaaagtcaagcaataccgtgaagaacttgatgccaagtttaatgctgataaatttaaatgggacaaaatgtgccatagagaagctgcagtaatgttgaaagcgtttttcagagaactacccacctctctcttccctgtggaatatatacctgccttcatcagtctaatggaaagagggcctcacgtcaaagtacagtttcaagccttacacctcatggtcatggcgctgcctgatgccaacagagatgcagctcaggccctcatgacattcttcaataaagtgattgccaatgaatcaaaaaaccgaatgagtctgtggaacatttctacagtgatggcaccgaaccttttcttcagtagaagcaaacactctgattatgaagaattactgttagcaaacactgcggcccacatcatccgcctaatgcttaagtaccagaagattttgtggaaggttccgtctttcttaatcactcaagtaagaagaatgaatgaagccacgatgctattgaagaagcagctcccaagtgtcaggaagctgctcaggaggaagaccctcgagcgggagactgcaagccccaagacttcaaaggtactgcaaaaatcaccctcggcaagacgaatgtctgacgtgccggaaggagtcatacgggtccatgctccacttctctccaaggtgtccatggccattcaactcaacaatcaaaccaaagccaaagacatattggcaaaatttcaatatgaaaacagtcatggttcatcagaatgtattaagattcagaaccaaaggttatatgaaattggaggaaatataggagagcattgcttggatccagatgcttatatattggatgtatatcgtataaatcctcaagcagaatgggtgattaaaccccaaccaagttcttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - Rho GTPase activating protein 29
- transcobalamin II; macrocytic anemia
- acid phosphatase 6, lysophosphatidic
- coronin, actin binding protein, 1C

Buy ARHGAP28-Rho GTPase activating protein 28 Gene now

Add to cart