LECT1-leukocyte cell derived chemotaxin 1 Gene View larger

LECT1-leukocyte cell derived chemotaxin 1 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LECT1-leukocyte cell derived chemotaxin 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about LECT1-leukocyte cell derived chemotaxin 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC025659
Product type: DNA & cDNA
Ncbi symbol: LECT1
Origin species: Human
Product name: LECT1-leukocyte cell derived chemotaxin 1 Gene
Size: 2ug
Accessions: BC025659
Gene id: 11061
Gene description: leukocyte cell derived chemotaxin 1
Synonyms: LECT1; BRICD3; CHM-I; CHM1; MYETS1; leukocyte cell-derived chemotaxin 1; BRICHOS domain containing 3; chondromodulin-1; chondromodulin-I; leukocyte cell derived chemotaxin 1; multiple myeloma tumor suppressor 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacagagaactccgacaaagttcccattgccctggtgggacctgatgacgtggaattctgcagccccccggcgtacgctacgctgacggtgaagccctccagccccgcgcggctgctcaaggtgggagccgtggtcctcatttcgggagctgtgctgctgctctttggggccatcggggccttctacttctggaaggggagcgacagtcacatttacaatgtccattacaccatgagtatcaatgggaaattacaagatgggtcaatggaaatagacgctgggaacaacttggagacctttaaaatgggaagtggagctgaagaagcaattgcagttaatgatttccagaatggcatcacaggaattcgttttgctggaggagagaagtgctacattaaagcgcaagtgaaggctcgtattcctgaggtgggcgccgtgaccaaacagagcatctcctccaaactggaaggcaagatcatgccagtcaaatatgaagaaaattctcttatctgggtggctgtagatcagcctgtgaaggacaacagcttcttgagttctaaggtgttagaactctgcggtgaccttcctattttctggcttaaaccaacctatccaaaagaaatccagagggaaagaagagaagtggtaagaaaaattgttccaactaccacaaaaagaccacacagtggaccacggagcaacccaggcgctggaagactgaataatgaaaccagacccagtgttcaagaggactcacaagccttcaatcctgataatccttatcatcaggaaggggaaagcatgacattcgaccctagactggatcacgaaggaatctgttgtatagaatgtaggcggagctacacccactgccagaagatctgtgaacccctggggggctattacccatggccttataattatcaaggctgccgttcggcctgcagagtcatcatgccatgtagctggtgggtggcccgtatcttgggcatggtgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - MAP3K12 binding inhibitory protein 1
- gap junction protein, alpha 5, 40kDa
- paroxysmal nonkinesigenic dyskinesia
- Rho GTPase activating protein 28

Buy LECT1-leukocyte cell derived chemotaxin 1 Gene now

Add to cart