NKD2-naked cuticle homolog 2 (Drosophila) Gene View larger

NKD2-naked cuticle homolog 2 (Drosophila) Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NKD2-naked cuticle homolog 2 (Drosophila) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about NKD2-naked cuticle homolog 2 (Drosophila) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012176
Product type: DNA & cDNA
Ncbi symbol: NKD2
Origin species: Human
Product name: NKD2-naked cuticle homolog 2 (Drosophila) Gene
Size: 2ug
Accessions: BC012176
Gene id: 85409
Gene description: naked cuticle homolog 2 (Drosophila)
Synonyms: Dvl-binding protein NKD2; Naked2; protein naked cuticle homolog 2; naked cuticle homolog 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggggaaactgcagtcgaagcacgccgccgccgcccgcaagcggagagagagcccggaaggggacagcttcgtggcgtccgcgtacgcgagcggccgcaaaggcgcggaggaagcggagcggcgcgcgcgggacaagcaggagctgcccaatggggaccccaaggaggggcctttccgggaggaccagtgtcccctacaggtggcactccccgctgagaaagctgagggccgcgagcacccgggacaactcctcagcgcagatgacggagagagggcagcaaaccgcgagggcccgcgaggaccgggcgggcagcgcctcaacattgacgcactccagtgcgatgtctcggtggaggaggacgaccgccaggagtggacgttcacgctctatgactttgacaactgcgggaaggtcaccagggaggacatgtccagcctcatgcacaccatctatgaggtcgtggatgcctcggtcaaccactcctcgggcagcagcaagaccctccgtgtgaagctaaccgtcagccctgagccctccagcaagaggaaggagggtcctcctgctggccaggaccgggagcccacccgttgcaggatggagggtgaactggcagaggagccaagggtggctgacaggaggttgtctgcacacgtcaggaggcccagtactgacccccagccctgctcggagcgggggccctactgcgtggacgagaacacggagcgcagaaaccactacctggacctcgccgggattgagaactacacgtccagattcggccctgggtctcagctgtgcgagaagagaagctccgctcccaggacacacagtggggacaaggctagaggagtcggcctttgcagggagctgtggagccaggcaggtcacccacagtggccaggccccttcccttcagggctggtggccgtctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - sorbin and SH3 domain containing 3
- hydroxysteroid dehydrogenase like 1
- keratinocyte associated protein 2
- leukocyte cell derived chemotaxin 1

Buy NKD2-naked cuticle homolog 2 (Drosophila) Gene now

Add to cart