CCDC90B-coiled-coil domain containing 90B Gene View larger

CCDC90B-coiled-coil domain containing 90B Gene

PTXBC014573

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CCDC90B-coiled-coil domain containing 90B Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CCDC90B-coiled-coil domain containing 90B Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014573
Product type: DNA & cDNA
Ncbi symbol: CCDC90B
Origin species: Human
Product name: CCDC90B-coiled-coil domain containing 90B Gene
Size: 2ug
Accessions: BC014573
Gene id: 60492
Gene description: coiled-coil domain containing 90B
Synonyms: MDS011; MDS025; coiled-coil domain-containing protein 90B, mitochondrial; coiled-coil domain containing 90B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaatagtcgccaggcttggcggctctttctctcccaaggcagaggagatcgttgggtttcaaggccccgcgggcatttctcgccggccctgcggagagagttcttcactaccacaaccaaggagggatatgataggcggccagtggatataactcctttagaacaaaggaaattaacttttgatacccatgcattggttcaggacttggaaactcatggatttgacaaaacacaagcagaaacaattgtatcagcgttaactgctttatcaaatgtcagcctggatactatctataaagagatggtcactcaagctcaacaggaaataacagtacaacagctaatggctcatttggatgctatcaggaaagacatggtcatcctagagaaaagtgaatttgcaaatctgagagcagagaatgagaaaatgaaaattgaattagaccaagttaagcaacaactaatgcatgaaaccagtcgaatcagagcagataataaactggatatcaacttagaaaggagcagagtaacagatatgtttacagatcaagaaaagcaacttatggaaacaactacagaatttacaaaaaaggatactcaaaccaaaagtattatttcagagaccagtaataaaattgacgctgaaattgcttccttaaaaacactgatggaatctaacaaacttgagacaattcgttatcttgcagcttcggtgtttacttgcctggcaatagcattgggattttatagattctggaagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - hematopoietically expressed homeobox
- T cell receptor beta variable 5-4
- naked cuticle homolog 2 (Drosophila)
- sorbin and SH3 domain containing 3

Buy CCDC90B-coiled-coil domain containing 90B Gene now

Add to cart