KRTAP4-12-keratin associated protein 4-12 Gene View larger

KRTAP4-12-keratin associated protein 4-12 Gene

PTXBC004180

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of KRTAP4-12-keratin associated protein 4-12 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about KRTAP4-12-keratin associated protein 4-12 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC004180
Product type: DNA & cDNA
Ncbi symbol: KRTAP4-12
Origin species: Human
Product name: KRTAP4-12-keratin associated protein 4-12 Gene
Size: 2ug
Accessions: BC004180
Gene id: 83755
Gene description: keratin associated protein 4-12
Synonyms: KAP4.12; KRTAP4.12; keratin-associated protein 4-12; keratin-associated protein 4.12; ultrahigh sulfur keratin-associated protein 4.12; keratin associated protein 4-12
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtcaactcctgttgtggctctgtgtgctctgaccagggctgtggcctggagaactgctgccgccccagctgctgccagaccacctgctgcaggaccacctgctgccgccccagctgctgtgtgtccagctgctgcaggccccagtgctgccagtctgtgtgctgtcagcccacctgctgccgccccagctgctgtcagaccacctgctgtaggaccacctgctgccgccccagctgctgtgtgtccagctgctgcagaccccagtgctgccagtctgtgtgctgccagcccacctgctgccgccccagctgctgtcagaccacctgctgcaggaccacttgctgccgccccagctgctgtgtgtccagctgctgcagaccccagtgctgccagtctgtgtgctgccagcccacctgctgccgccccagctgctgcatctccagcagctgctgcccctcttgctgtgaatccagctgctgccgcccctgctgctgcctgcgtccagtctgtggccgagtctcctgccacaccacttgctatcgcccaacctgtgtcatctccacctgcccccgccccttgtgctgtgcctcctcttgctgctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - nuclear transcription factor Y, beta
- RAB27B, member RAS oncogene family
- coiled-coil domain containing 90B
- hematopoietically expressed homeobox

Buy KRTAP4-12-keratin associated protein 4-12 Gene now

Add to cart