Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of PPIL1-peptidylprolyl isomerase (cyclophilin)-like 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PPIL1-peptidylprolyl isomerase (cyclophilin)-like 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC003048 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PPIL1 |
| Origin species: | Human |
| Product name: | PPIL1-peptidylprolyl isomerase (cyclophilin)-like 1 Gene |
| Size: | 2ug |
| Accessions: | BC003048 |
| Gene id: | 51645 |
| Gene description: | peptidylprolyl isomerase (cyclophilin)-like 1 |
| Synonyms: | rotamase PPIL1; CGI-124; CYPL1; PPIase; hCyPX; peptidyl-prolyl cis-trans isomerase-like 1; cyclophilin like 1; cyclophilin-related gene 1; peptidyl-prolyl cis-trans isomerase; peptidylprolyl isomerase (cyclophilin)-like 1; peptidylprolyl isomerase like 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggcaattcccccagattcctggcagccacccaacgtttacttggagaccagcatgggaatcattgtgctggagctgtactggaagcatgctccaaagacctgtaagaactttgctgagttggctcgtcgaggttactacaatggcacaaaattccacagaattatcaaagacttcatgatccaaggaggtgacccaacagggacaggtcgaggtggtgcatctatctatggcaaacagtttgaagatgaacttcatccagacttgaaattcacgggggctggaattctcgcaatggccaatgcggggccagataccaatggcagccagttctttgtgaccctcgcccccacccagtggcttgacggcaaacacaccatttttggccgagtgtgtcagggcataggaatggtgaatcgcgtgggaatggtagaaacaaactcccaggaccgccctgtggacgacgtgaagatcattaaggcatacccttctgggtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - iron-sulfur cluster scaffold homolog (E. coli) - PRKR interacting protein 1 (IL11 inducible) - glucosamine-phosphate N-acetyltransferase 1 - gem (nuclear organelle) associated protein 8 |