PRKRIP1-PRKR interacting protein 1 (IL11 inducible) Gene View larger

PRKRIP1-PRKR interacting protein 1 (IL11 inducible) Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PRKRIP1-PRKR interacting protein 1 (IL11 inducible) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PRKRIP1-PRKR interacting protein 1 (IL11 inducible) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014298
Product type: DNA & cDNA
Ncbi symbol: PRKRIP1
Origin species: Human
Product name: PRKRIP1-PRKR interacting protein 1 (IL11 inducible) Gene
Size: 2ug
Accessions: BC014298
Gene id: 79706
Gene description: PRKR interacting protein 1 (IL11 inducible)
Synonyms: C114; KRBOX3; PRKR-interacting protein 1; KRAB box domain containing 3; likely ortholog of mouse C114 dsRNA-binding protein; PRKR interacting protein 1 (IL11 inducible)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctagcccagccgcctcctcggtgcgaccaccgaggcccaagaaagagccgcagacgctcgtcatccccaagaatgcggcggaggagcagaagctcaagctggagcggctcatgaagaacccggacaaagcagttccaattccagagaaaatgagtgaatgggcacctcgacctcccccagaatttgtccgagatgtcatgggttcaagtgctggggccggcagtggagagttccacgtgtacagacatctgcgccggagagaatatcagcgacaggactacatggatgccatggctgagaagcaaaaattgtatgcagagtttcagaaaagactggaaaagaataaaattgctgcagaggagcagaccgcaaagcgccggaagaagcgccagaagttaaaagagaagaaattactggcaaagaagatgaaacttgaacagaagaaacaagaaggacccggtcagcccaaggagcaggggtccagcagctctgcggaggcatctggaacagaggaggaggaggaagtgcccagtttcaccatggggcgatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - glucosamine-phosphate N-acetyltransferase 1
- gem (nuclear organelle) associated protein 8
- insulin-like growth factor binding protein 4
- far upstream element (FUSE) binding protein 3

Buy PRKRIP1-PRKR interacting protein 1 (IL11 inducible) Gene now

Add to cart