Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of GEMIN8-gem (nuclear organelle) associated protein 8 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GEMIN8-gem (nuclear organelle) associated protein 8 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC003607 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GEMIN8 |
| Origin species: | Human |
| Product name: | GEMIN8-gem (nuclear organelle) associated protein 8 Gene |
| Size: | 2ug |
| Accessions: | BC003607 |
| Gene id: | 54960 |
| Gene description: | gem (nuclear organelle) associated protein 8 |
| Synonyms: | FAM51A1; gem-associated protein 8; family with sequence similarity 51, member A1; gemin-8; gem nuclear organelle associated protein 8 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcagcggtaaaggcatcaacatcgaaagctaccaggccttggtattctcatccggtatatgcaagatactggcaacattatcatcaagcaatggcttggatgcaaagccatcacaatgcctacaggaaggccgtggaatcctgtttcaatcttccatggtacttaccttctgcgcttcttccccaaagctcttacgataatgaggctgcgtatcctcagtccttctatgaccatcatgtggcctggcaggactacccctgcagttcttcacatttcagaagatctgggcagcatccacgttacagcagtaggatccaggcatccacaaaagaagaccaagctttgtccaaagaggaagagatggagactgagtcagatgcagaggtagaatgtgacctgagcaatatggaaatcactgaagagctccgccagtactttgcagagaccgagaggcatagagaagaacgacggcggcagcagcagctggatgcagagcgcctggacagctatgtgaacgctgaccacgacctgtactgcaacacccgccggtcggtagaagccccaactgagaggcctggtgagcggcgccaggccgagatgaagcgtttgtacggggacagtgctgccaagatccaagccatggaggccgcggtgcagctgagctttgacaagcactgtgaccgaaagcagcccaagtactggccggtcatccccctgaagttctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - insulin-like growth factor binding protein 4 - far upstream element (FUSE) binding protein 3 - tRNA selenocysteine 1 associated protein 1 - family with sequence similarity 49, member B |