Login to display prices
Login to display prices
GEMIN8-gem (nuclear organelle) associated protein 8 Gene View larger

GEMIN8-gem (nuclear organelle) associated protein 8 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GEMIN8-gem (nuclear organelle) associated protein 8 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about GEMIN8-gem (nuclear organelle) associated protein 8 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC003607
Product type: DNA & cDNA
Ncbi symbol: GEMIN8
Origin species: Human
Product name: GEMIN8-gem (nuclear organelle) associated protein 8 Gene
Size: 2ug
Accessions: BC003607
Gene id: 54960
Gene description: gem (nuclear organelle) associated protein 8
Synonyms: FAM51A1; gem-associated protein 8; family with sequence similarity 51, member A1; gemin-8; gem nuclear organelle associated protein 8
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcagcggtaaaggcatcaacatcgaaagctaccaggccttggtattctcatccggtatatgcaagatactggcaacattatcatcaagcaatggcttggatgcaaagccatcacaatgcctacaggaaggccgtggaatcctgtttcaatcttccatggtacttaccttctgcgcttcttccccaaagctcttacgataatgaggctgcgtatcctcagtccttctatgaccatcatgtggcctggcaggactacccctgcagttcttcacatttcagaagatctgggcagcatccacgttacagcagtaggatccaggcatccacaaaagaagaccaagctttgtccaaagaggaagagatggagactgagtcagatgcagaggtagaatgtgacctgagcaatatggaaatcactgaagagctccgccagtactttgcagagaccgagaggcatagagaagaacgacggcggcagcagcagctggatgcagagcgcctggacagctatgtgaacgctgaccacgacctgtactgcaacacccgccggtcggtagaagccccaactgagaggcctggtgagcggcgccaggccgagatgaagcgtttgtacggggacagtgctgccaagatccaagccatggaggccgcggtgcagctgagctttgacaagcactgtgaccgaaagcagcccaagtactggccggtcatccccctgaagttctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - insulin-like growth factor binding protein 4
- far upstream element (FUSE) binding protein 3
- tRNA selenocysteine 1 associated protein 1
- family with sequence similarity 49, member B