ISCU-iron-sulfur cluster scaffold homolog (E. coli) Gene View larger

ISCU-iron-sulfur cluster scaffold homolog (E. coli) Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ISCU-iron-sulfur cluster scaffold homolog (E. coli) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ISCU-iron-sulfur cluster scaffold homolog (E. coli) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC011906
Product type: DNA & cDNA
Ncbi symbol: ISCU
Origin species: Human
Product name: ISCU-iron-sulfur cluster scaffold homolog (E. coli) Gene
Size: 2ug
Accessions: BC011906
Gene id: 23479
Gene description: iron-sulfur cluster scaffold homolog (E. coli)
Synonyms: IscU iron-sulfur cluster scaffold homolog; iron-sulfur cluster assembly enzyme ISCU, mitochondrial; 2310020H20Rik; HML; ISU2; NIFU; NIFUN; hnifU; nifU-like N-terminal domain-containing protein; iron-sulfur cluster assembly enzyme
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggcggctggggctggccgtctgaggcgggtggcatcggctctgctgctgcggagcccccgcctgcccgcccgggagctgtcggccccggcccgactctatcacaagaaggttgttgatcattatgaaaatcctagaaacgtggggtcccttgacaagacatctaaaaatgttggaactggactggtgggggctccagcatgtggtgacgtaatgaaattacagattcaagtggatgaaaaggggaagattgtggatgctaggtttaaaacatttggctgtggttccgcaattgcctccagctcattagccactgaatgggtgaaaggaaagacggtggaggaagccttgactatcaaaaacacagatatcgccaaggagctctgccttcctcccgtgaaactgcactgctccatgctggctgaagatgcaatcaaggccgccctggctgattacaaattgaaacaagaacccaaaaaaggagaggcagagaagaaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - PRKR interacting protein 1 (IL11 inducible)
- glucosamine-phosphate N-acetyltransferase 1
- gem (nuclear organelle) associated protein 8
- insulin-like growth factor binding protein 4

Buy ISCU-iron-sulfur cluster scaffold homolog (E. coli) Gene now

Add to cart