Login to display prices
Login to display prices
TMEM176A-transmembrane protein 176A Gene View larger

TMEM176A-transmembrane protein 176A Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TMEM176A-transmembrane protein 176A Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TMEM176A-transmembrane protein 176A Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008303
Product type: DNA & cDNA
Ncbi symbol: TMEM176A
Origin species: Human
Product name: TMEM176A-transmembrane protein 176A Gene
Size: 2ug
Accessions: BC008303
Gene id: 55365
Gene description: transmembrane protein 176A
Synonyms: GS188; HCA112; MS4B1; transmembrane protein 176A; hepatocellular carcinoma-associated antigen 112; likley ortholog of mouse GS188
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggaacagccgacagtgatgagatggccccggaggccccacagcacacccacatcgatgtgcacatccaccaggagtctgccctggccaagctcctgctcacctgctgctctgcgctgcggccccgggccacccaggccaggggcagcagccggctgctggtggcctcgtgggtgatgcagatcgtgctggggatcttgagtgcagtcctaggaggatttttctacatccgcgactacaccctcctcgtcacctcgggagctgccatctggacaggggctgtggctgtgctggctggagctgctgccttcatttacgagaaacggggtggtacatactgggccctgctgaggactctgctaacgctggcagctttctccacagccatcgctgccctcaaactttggaatgaagatttccgatatggctactcttattacaacagtgcctgccgcatctccagctcgagtgactggaacactccagcccccactcagagtccagaagaagtcagaaggctacacctatgtacctccttcatggacatgctgaaggccttgttcagaacccttcaggccatgctcttgggtgtctggattctgctgcttctggcatctctgacccctctgtggctgtactgctggagaatgttcccaaccaaagggaaaagagaccagaaggaaatgttggaagtgagtggaatctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - thiopurine S-methyltransferase
- BCL2-like 12 (proline rich)
- prune homolog 2 (Drosophila)
- kallikrein-related peptidase 3