BCL2L12-BCL2-like 12 (proline rich) Gene View larger

BCL2L12-BCL2-like 12 (proline rich) Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of BCL2L12-BCL2-like 12 (proline rich) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about BCL2L12-BCL2-like 12 (proline rich) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007724
Product type: DNA & cDNA
Ncbi symbol: BCL2L12
Origin species: Human
Product name: BCL2L12-BCL2-like 12 (proline rich) Gene
Size: 2ug
Accessions: BC007724
Gene id: 83596
Gene description: BCL2-like 12 (proline rich)
Synonyms: bcl-2-like protein 12; BCL2-like 12 (proline rich); Bcl-2 related proline-rich protein; BCL2 like 12
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcaggctctgaagagctggggctccgggaagacacgctgagggtcctagctgccttccttaggcgtggtgaggctgccgggtctcctgttccaactccacctagaagccctgcccaagaagagccaacagacttcctgagccgccttcgaagatgtcttccctgctccctggggcgaggagcagccccctctgagtcccctcggccttgctctctgcccatccgcccctgctatggtttagagcctggcccagctactccagacttctatgctttggtggcccagcggctggaacagctggtccaagagcagctgaaatctccgcccagcccagaattacagggtcccccatcgacagagaaggaagccatactgcggaggctggtggccctgctggaggaggaggcagaagtcattaaccagaagctggcctcggaccccgccctgcgcagcaagctggtccgcctgtcctccgactctttcgcccgcctggtggagctgttctgtagccgggatgacagctctcgcccaagccgagcatgccccgggccctcgcctccttccccggagcccctggcccgcctggccctagccatggagctgagccggcgcgtggccgggctggggggcaccctggccggactcagcgtggagcacgtgcacagcttcacgccctggatccaggcccacgggggctgggagggcatcctggctgtttcacccgtggacttgaacttgccattggactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - prune homolog 2 (Drosophila)
- kallikrein-related peptidase 3
- nucleosomal binding protein 1
- melanoma antigen family A, 9

Buy BCL2L12-BCL2-like 12 (proline rich) Gene now

Add to cart