NSBP1-nucleosomal binding protein 1 Gene View larger

NSBP1-nucleosomal binding protein 1 Gene

PTXBC005342

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NSBP1-nucleosomal binding protein 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about NSBP1-nucleosomal binding protein 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005342
Product type: DNA & cDNA
Ncbi symbol: NSBP1
Origin species: Human
Product name: NSBP1-nucleosomal binding protein 1 Gene
Size: 2ug
Accessions: BC005342
Gene id: 79366
Gene description: nucleosomal binding protein 1
Synonyms: NSBP1; NBP-45; high mobility group nucleosome-binding domain-containing protein 5; nucleosomal binding protein 1; nucleosome-binding protein 1; high mobility group nucleosome binding domain 5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcccaaaagaaaggctgcaggtcaaggtgatatgaggcaggagccaaagagaagatctgccaggttgtctgctatgcttgtgccagttacaccagaggtgaagcctaaaagaacatcaagttcaaggaaaatgaagacaaaaagtgatatgatggaagaaaacatagatacaagtgcccaagcagttgctgaaaccaagcaagaagcagttgttgaagaagactacaatgaaaatgctaaaaatggagaagccaaaattacagaggcaccagcttctgaaaaagaaattgtggaagtaaaagaagaaaatattgaagatgccacagaaaagggaggagaaaagaaagaagcagtggcagcagaagtaaaaaatgaagaagaagatcagaaagaagatgaagaagatcaaaacgaagagaaaggggaagctggaaaagaagacaaagatgaaaaaggggaagaagatggaaaagaggataaaaatggaaatgagaaaggagaagatgcaaaagagaaagaagatggaaaaaaaggtgaagacggaaaaggaaatggagaagatggaaaagagaaaggagaagatgaaaaagaggaagaagacagaaaagaaacaggagatggaaaagagaatgaagatggaaaagagaagggagataaaaaagaggggaaagatgtaaaagtcaaagaagatgaaaaagagagagaagatggaaaagaagatgaaggtggaaatgaggaagaagctggaaaagagaaagaagatttaaaagaagaggaagaaggaaaagaggaagatgagatcaaagaagatgatggaaaaaaagaggagccacagagtattgtttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - melanoma antigen family A, 9
- homer homolog 3 (Drosophila)
- polymerase (DNA directed), eta
- RNA methyltransferase like 1

Buy NSBP1-nucleosomal binding protein 1 Gene now

Add to cart