RNMTL1-RNA methyltransferase like 1 Gene View larger

RNMTL1-RNA methyltransferase like 1 Gene

PTXBC011550

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RNMTL1-RNA methyltransferase like 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RNMTL1-RNA methyltransferase like 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC011550
Product type: DNA & cDNA
Ncbi symbol: RNMTL1
Origin species: Human
Product name: RNMTL1-RNA methyltransferase like 1 Gene
Size: 2ug
Accessions: BC011550
Gene id: 55178
Gene description: RNA methyltransferase like 1
Synonyms: RNMTL1; RMTL1; rRNA methyltransferase 3, mitochondrial; 16S rRNA (guanosine(1370)-2'-O)-methyltransferase; 16S rRNA [Gm1370] 2'-O-methyltransferase; RNA methyltransferase like 1; RNA methyltransferase-like protein 1; mitochondrial rRNA methyltransferase 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggcgctggtgagaccctcgaggtttgtcgtgcgaccgttgctgcaggtggtccaggcttgggaccttgacgcgaggcgctgggtccgggcgctgcggcggagcccagtgaaagtggtgtttccttccggagaggtggtggaacagaagcgcgctcctgggaagcagccccgcaaggcaccatctgaggccagtgcccaggagcaacgagagaaacaaccgctcgaggagtccgcatcccgcgctcccagcacctgggaagagtctgggcttcgctacgataaagcttatcccggggacaggaggctgagcagtgtaatgacaatagtaaagtccaggccatttcgggaaaaacaagggaagatcctgctggaaggtcgcaggctcatttcagacgctctcaaggctggagctgtgccaaaaatgttcttctttagccgtctagaatacctaaaggagttgccagtcgataagctgaaaggtgtcagcctcattaaggtgaaatttgaggatatcaaggattggtccgacctcgtaacgccacaaggaataatggggatttttgccaagcctgaccatgttaagatgacatatccaaagactcagcttcagcattcactgcctttattattgatttgtgacaatctccgtgaccctgggaacctggggacaattctgagatctgcagctggggcaggctgcagcaaagtgttactcaccaaaggctgtgtggatgcctgggagcccaaagtgctccgggcgggtatgggcgcacatttccggatgcccattatcaataatctggaatgggaaaccgtgcccaattacctgccccctgacactcgggtctatgtggctgacaactgtggcctttatgcccaggctgagatgtctaataaagctagtgaccatggctgggtgtgtgatcaacgagtgatgaagtttcacaagtatgaggaagaggaagatgtagaaaccggagccagtcaagattggctgcctcatgttgaggttcagagttacgactcggactggacagaggcgccggcagctgtggtgattggcggggagacctacggcgtgagcctggagtccctgcagctggccgagagcactggtggcaagaggctgctgatccccgttgtgcctggtgtggacagcctcaactcggccatggcggcaagcatcctgcttttcgaagggaaaagacagctgcgggggagggcggaggacttgagcagggacaggagttaccactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - interferon regulatory factor 4
- misato homolog 1 (Drosophila)
- multiple endocrine neoplasia I
- melanoma antigen family D, 2

Buy RNMTL1-RNA methyltransferase like 1 Gene now

Add to cart