POLH-polymerase (DNA directed), eta Gene View larger

POLH-polymerase (DNA directed), eta Gene

PTXBC015742

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of POLH-polymerase (DNA directed), eta Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about POLH-polymerase (DNA directed), eta Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015742
Product type: DNA & cDNA
Ncbi symbol: POLH
Origin species: Human
Product name: POLH-polymerase (DNA directed), eta Gene
Size: 2ug
Accessions: BC015742
Gene id: 5429
Gene description: polymerase (DNA directed), eta
Synonyms: RAD30; RAD30A; XP-V; XPV; DNA polymerase eta; RAD30 homolog A; polymerase (DNA directed), eta; polymerase (DNA) eta; xeroderma pigmentosum variant type protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctactggacaggatcgagtggttgctctcgtggacatggactgtttttttgttcaagtggagcagcggcaaaatcctcatttgaggaataaaccttgtgcagttgtacagtacaaatcatggaagggtggtggaataattgcagtgagttatgaagctcgtgcatttggagtcactagaagtatgtgggcagatgatgctaagaagttatgtccagatcttctactggcacaagttcgtgagtcccgtgggaaagctaacctcaccaagtaccgggaagccagtgttgaagtgatggagataatgtctcgttttgctgtgattgaacgtgccagcattgatgaggcttacgtagatctgaccagtgctgtacaagagagactacaaaagctacaaggtcagcctatctcggcagacttgttgccaagcacttacattgaagggttgccccaaggccctacaacggcagaagagactgttcagaaagaggggatgcgaaaacaaggcttatttcaatggctcgattctcttcagattgataacctcacctctccagacctgcagctcaccgtgggagcagtgattgtggaggaaatgagagcagccatagagagggagactggttttcagtgttcagctggaatttcacacaataaggtcctggcaaaactggcctgtggactaaacaagcccaaccgccaaaccctggtttcacatgggtcagtcccacagctcttcagccaaatgcccattcgcaaaatccgtagtcttggaggaaagctaggggcctctgtcattgagatcctagggatagaatacatgggtgaactgacccagttcactgaatcccagctccagagtcattttggggagaagaatgggtcttggctatatgccatgtgccgagggattgaacatgatccagttaaacccaggcaactacccaaaaccattggctgtagtaagaacttcccaggaaaaacagctcttgctactcgggaacaggtacaatggtggctgttgcaattagcccaggaactagaggagagactgactaaagaccgaaatgataatgacagggtagccacccagctggttgtgagcattcgtgtacaaggagacaaacgcctcagcagcctgcgccgctgctgtgcccttacccgctatgatgctcacaagatgagccatgatgcatttactgtcatcaagaactgtaatacttctggaatccagacagaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - RNA methyltransferase like 1
- interferon regulatory factor 4
- misato homolog 1 (Drosophila)
- multiple endocrine neoplasia I

Buy POLH-polymerase (DNA directed), eta Gene now

Add to cart