Cart 2 Product Products 226,80 € (empty)
-
1 x PNOC-prepr...113,40 € -
1 x LRRN4CL-LR...113,40 €
No products
To be determined Shipping
226,80 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 2 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 226,80 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 226,80 €
Data sheet of MAGEA9-melanoma antigen family A, 9 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MAGEA9-melanoma antigen family A, 9 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC002351 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MAGEA9 |
| Origin species: | Human |
| Product name: | MAGEA9-melanoma antigen family A, 9 Gene |
| Size: | 2ug |
| Accessions: | BC002351 |
| Gene id: | 4108 |
| Gene description: | melanoma antigen family A, 9 |
| Synonyms: | CT1.9; MAGE9; melanoma-associated antigen 9; MAGE-9 antigen; cancer/testis antigen 1.9; cancer/testis antigen family 1, member 9; melanoma antigen family A, 9; melanoma antigen family A9; MAGE family member A9 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtctctcgagcagaggagtccgcactgcaagcctgatgaagaccttgaagcccaaggagaggacttgggcctgatgggtgcacaggaacccacaggcgaggaggaggagactacctcctcctctgacagcaaggaggaggaggtgtctgctgctgggtcatcaagtcctccccagagtcctcagggaggcgcttcctcctccatttccgtctactacactttatggagccaattcgatgagggctccagcagtcaagaagaggaagagccaagctcctcggtcgacccagctcagctggagttcatgttccaagaagcactgaaattgaaggtggctgagttggttcatttcctgctccacaaatatcgagtcaaggagccggtcacaaaggcagaaatgctggagagcgtcatcaaaaattacaagcgctactttcctgtgatcttcggcaaagcctccgagttcatgcaggtgatctttggcactgatgtgaaggaggtggaccccgccggccactcctacatccttgtcactgctcttggcctctcgtgcgatagcatgctgggtgatggtcatagcatgcccaaggccgccctcctgatcattgtcctgggtgtgatcctaaccaaagacaactgcgcccctgaagaggttatctgggaagcgttgagtgtgatgggggtgtatgttgggaaggagcacatgttctacggggagcccaggaagctgctcacccaagattgggtgcaggaaaactacctggagtaccggcaggtgcccggcagtgatcctgcgcactacgagttcctgtggggttccaaggcccacgctgaaaccagctatgagaaggtcataaattatttggtcatgctcaatgcaagagagcccatctgctacccatccctttatgaagaggttttgggagaggagcaagagggagtctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - homer homolog 3 (Drosophila) - polymerase (DNA directed), eta - RNA methyltransferase like 1 - interferon regulatory factor 4 |