Login to display prices
Login to display prices
PRUNE2-prune homolog 2 (Drosophila) Gene View larger

PRUNE2-prune homolog 2 (Drosophila) Gene

PTXBC019095

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PRUNE2-prune homolog 2 (Drosophila) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PRUNE2-prune homolog 2 (Drosophila) Gene

Proteogenix catalog: PTXBC019095
Ncbi symbol: PRUNE2
Product name: PRUNE2-prune homolog 2 (Drosophila) Gene
Size: 2ug
Accessions: BC019095
Gene id: 158471
Gene description: prune homolog 2 (Drosophila)
Synonyms: truncated PRUNE2; BMCC1; BNIPXL; C9orf65; KIAA0367; protein prune homolog 2; BCH motif-containing molecule at the carboxyl terminal region 1; BNIP2 motif containing molecule at the carboxyl terminal region 1; BNIP2 motif-containing molecule at the C-terminal region 1; olfaxin; prune homolog 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaagaatttttgcaacgcgccaaatctaaactgaatcgaagcaaacgcttggagaaggtccatgtggttattgggcctaaatcgtgtgacttggattctctcatttctaccttcacatatgcttactttctagacaaggtcagtccaccaggggttctgtgtttaccagtgctgaacataccaagaactgaattcaactacttcaccgagacgaggtttattttagaagagctaaatatttccgaatcattccacatattccgggatgaaattaacctgcatcagctaaatgatgaagggaagttatcgataacacttgttggcagcagtgtgctggcgagtgaagacaaaactttagaatcagcagttgtcaaagtcattaatccggttgagcagagcgatgccaacgttgagttccgagagtcttcctcttctctcgtgctaaaggagattctccaagaggctcctgagctcatcaccgagcaactggctcatcgcctcagaggtagcattcttttcaagtggatgaccatggaatcagagaagatctcagagaagcaggaggaaattctttctatcctggaagaaaaatttcctaacttgcctccaagagaggacatcatcaacgtcctacaggagacccagttcagtgctcagggtttaagtattgaacagacaatgttgaaagatctaaaggagctgtcagatggagaaataaaagtggccattagtactgtgagcatgaaccttgaggtaagggtgggaatgcttttttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: