TPMT-thiopurine S-methyltransferase Gene View larger

TPMT-thiopurine S-methyltransferase Gene

PTXBC005339

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TPMT-thiopurine S-methyltransferase Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TPMT-thiopurine S-methyltransferase Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005339
Product type: DNA & cDNA
Ncbi symbol: TPMT
Origin species: Human
Product name: TPMT-thiopurine S-methyltransferase Gene
Size: 2ug
Accessions: BC005339
Gene id: 7172
Gene description: thiopurine S-methyltransferase
Synonyms: TPMTD; thiopurine S-methyltransferase; S-adenosyl-L-methionine:thiopurine S-methyltransferase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggatggtacaagaacttcacttgacattgaagagtactcggatactgaggtacagaaaaaccaagtactaactctggaagaatggcaagacaagtgggtgaacggcaagactgcttttcatcaggaacaaggacatcagctattaaagaagcatttagatactttccttaaaggcaagagtggactgagggtattttttcctctttgcggaaaagcggttgagatgaaatggtttgcagaccggggacacagtgtagttggtgtggaaatcagtgaacttgggatacaagaattttttacagagcagaatctttcttactcagaagaaccaatcaccgaaattcctggaaccaaagtatttaagagttcttcggggaacatttcattgtactgttgcagtatttttgatcttcccaggacaaatattggcaaatttgacatgatttgggatagaggagcattagttgccatcaatccaggtgatcgcaaatgctatgcagatacaatgttttccctcctgggaaagaagtttcagtatctcctgtgtgttctttcttatgatccaactaaacatccaggtccaccattttatgttccacatgctgaaattgaaaggttgtttggtaaaatatgcaatatacgtcgtcttgagaaggttgatgcttttgaagaacgacataaaagttggggaattgactgtctttttgaaaagttatatctacttacagaaaagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - BCL2-like 12 (proline rich)
- prune homolog 2 (Drosophila)
- kallikrein-related peptidase 3
- nucleosomal binding protein 1

Buy TPMT-thiopurine S-methyltransferase Gene now

Add to cart