Login to display prices
Login to display prices
GDPD1-glycerophosphodiester phosphodiesterase domain containing 1 Gene View larger

GDPD1-glycerophosphodiester phosphodiesterase domain containing 1 Gene

PTXBC034432

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GDPD1-glycerophosphodiester phosphodiesterase domain containing 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GDPD1-glycerophosphodiester phosphodiesterase domain containing 1 Gene

Proteogenix catalog: PTXBC034432
Ncbi symbol: GDPD1
Product name: GDPD1-glycerophosphodiester phosphodiesterase domain containing 1 Gene
Size: 2ug
Accessions: BC034432
Gene id: 284161
Gene description: glycerophosphodiester phosphodiesterase domain containing 1
Synonyms: GDE4; glycerophosphodiester phosphodiesterase domain-containing protein 1; glycerophosphodiester phosphodiesterase 4; glycerophosphodiester phosphodiesterase domain containing 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcgtccactgcggctttttaccttctctctacgctaggaggatacttggtgacctcattcttgttgcttaaatacccgaccttgctgcaccagagaaagaagcagcgattcctcagtaaacacatctctcaccgcggaggtgctggagaaaatttggagaatacaatggcagcctttcagcatgcggttaaaatcggaactgatatgctagaattggactgccatatcacaaaagatgaacaagttgtagtgtcacatgatgagaatctaaagagagcaactggggtcaatgtaaacatctctgatctcaaatactgtgagctcccaccttaccttggcaaactggatgtctcatttcaaagagcatgccagtgtgaaggaaaagataaccgaattccattactgaaggaagtttttgaggcctttcctaacactcccattaacatcgatatcaaagtcaacaacaatgtgctgattaagaaggtttcagagttggtgaagcggtataatcgagaacacttaacagtgtggggtaatgccaattatgaaattgtagaaaagtgctacaaagagaattcagatattcctatactcttcagtctacaacgtgtcctgctcattcttggccttttcttcactggcctcttgccctttgtgcccattcgagaacagttttttgaaatcccaatgccttctattatactgaagctaaaagaaccacacaccatgtccagaagtcaaaagtttctcatctggctttctgatctcttactaatgaggaaagctttgtttgaccacctaactgctcgaggcattcaagtaagtttctggaatgatgcattttggaagcagcatagctcaccagtttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: