GDPD1-glycerophosphodiester phosphodiesterase domain containing 1 Gene View larger

GDPD1-glycerophosphodiester phosphodiesterase domain containing 1 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GDPD1-glycerophosphodiester phosphodiesterase domain containing 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about GDPD1-glycerophosphodiester phosphodiesterase domain containing 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC034432
Product type: DNA & cDNA
Ncbi symbol: GDPD1
Origin species: Human
Product name: GDPD1-glycerophosphodiester phosphodiesterase domain containing 1 Gene
Size: 2ug
Accessions: BC034432
Gene id: 284161
Gene description: glycerophosphodiester phosphodiesterase domain containing 1
Synonyms: GDE4; glycerophosphodiester phosphodiesterase domain-containing protein 1; glycerophosphodiester phosphodiesterase 4; glycerophosphodiester phosphodiesterase domain containing 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcgtccactgcggctttttaccttctctctacgctaggaggatacttggtgacctcattcttgttgcttaaatacccgaccttgctgcaccagagaaagaagcagcgattcctcagtaaacacatctctcaccgcggaggtgctggagaaaatttggagaatacaatggcagcctttcagcatgcggttaaaatcggaactgatatgctagaattggactgccatatcacaaaagatgaacaagttgtagtgtcacatgatgagaatctaaagagagcaactggggtcaatgtaaacatctctgatctcaaatactgtgagctcccaccttaccttggcaaactggatgtctcatttcaaagagcatgccagtgtgaaggaaaagataaccgaattccattactgaaggaagtttttgaggcctttcctaacactcccattaacatcgatatcaaagtcaacaacaatgtgctgattaagaaggtttcagagttggtgaagcggtataatcgagaacacttaacagtgtggggtaatgccaattatgaaattgtagaaaagtgctacaaagagaattcagatattcctatactcttcagtctacaacgtgtcctgctcattcttggccttttcttcactggcctcttgccctttgtgcccattcgagaacagttttttgaaatcccaatgccttctattatactgaagctaaaagaaccacacaccatgtccagaagtcaaaagtttctcatctggctttctgatctcttactaatgaggaaagctttgtttgaccacctaactgctcgaggcattcaagtaagtttctggaatgatgcattttggaagcagcatagctcaccagtttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - solute carrier family 19 (thiamine transporter), member 2
- aldo-keto reductase family 1, member B1 (aldose reductase)
- aldo-keto reductase family 1, member B1 (aldose reductase)
- Parkinson disease (autosomal recessive, juvenile) 2, parkin

Buy GDPD1-glycerophosphodiester phosphodiesterase domain containing 1 Gene now

Add to cart