Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PARK2-Parkinson disease (autosomal recessive, juvenile) 2, parkin Gene
PTXBC022014
New product
Data sheet of PARK2-Parkinson disease (autosomal recessive, juvenile) 2, parkin Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PARK2-Parkinson disease (autosomal recessive, juvenile) 2, parkin Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC022014 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PARK2 |
| Origin species: | Human |
| Product name: | PARK2-Parkinson disease (autosomal recessive, juvenile) 2, parkin Gene |
| Size: | 2ug |
| Accessions: | BC022014 |
| Gene id: | 5071 |
| Gene description: | Parkinson disease (autosomal recessive, juvenile) 2, parkin |
| Synonyms: | AR-JP; LPRS2; PDJ; PRKN; E3 ubiquitin-protein ligase parkin; Parkinson disease (autosomal recessive, juvenile) 2, parkin; parkinson juvenile disease protein 2; parkinson protein 2 E3 ubiquitin protein ligase; parkinson protein 2, E3 ubiquitin protein ligase (parkin); parkin RBR E3 ubiquitin protein ligase |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgatagtgtttgtcaggttcaactccagccatggtttcccagtggaggtcgattctgacaccagcatcttccagctcaaggaggtggttgctaagcgacagggggttccggctgaccagttgcgtgtgattttcgcagggaaggagctgaggaatgactggactgtgcagaattgtgacctggatcagcagagcattgttcacattgtgcagagaccgtggagaaaaggtcaagaaatgaatgcaactggaggcgacgaccccagaaacgcggcgggaggctgtgagcgggagccccagagcttgactcgggtggacctcagcagctcagtcctcccaggagactctgtggggctggctgtcattctgcacactgacagcaggaaggactcaccaccagctggaagtccagcaggtagatcaatctacaacagcttttatgtgtattgtaaaggcccctgtcaaagagtgcagccggggaaactcagggtacagtgcagcacctgcaggcaggcaacgctcaccttgacccagggtccatcttgctgggatgatgttttaattccaaaccggatgagtggtgaatgccaatccccacactgccctgggactagtgcagaatttttctttaaatgtggagcacaccccacctctgacaaggaaacatcagtagctttgcacctgatcgcaacaaatagtcggaacatcacttgcattacgtgcacagacgtcaggagccccgtcctggttttccagtgcaactcccgccacgtgatttgcttagactgtttccacttatactgtgtgacaagactcaatgatcggcagtttgttcacgaccctcaacttggctactccctgccttgtgtgggaactggagacacagtggtgcttagaggagctctggggggattcaggagaggagtcgctggctgtcccaactccttgattaaagagctccatcacttcaggattctgggagaagagcagtacaaccggtaccagcagtatggtgcagaggagtgtgtcctgcagatggggggcgtgttatgcccccgccctggctgtggagcggggctgctgccggagcctgaccagaggaaagtcacctgcgaagggggcaatggcctgggctgtgggtatggacaacgaagaacaaaataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - LanC lantibiotic synthetase component C-like 1 (bacterial) - carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 8 - oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide) - carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 9 |