Cart 29 Product Products 3 397,41 € (empty)
-
1 x MRPS36-mit...113,40 € -
1 x SLC10A7-so...113,40 € -
1 x CD99-CD99...113,40 € -
-
1 x EIF2B1-euk...121,50 € -
1 x KHDRBS3-KH...121,50 € -
1 x LSM4-LSM4...113,40 € -
1 x ZIC4-Zic...121,50 € -
1 x KCNK4-pota...113,40 € -
1 x PPIA-pepti...113,40 € -
1 x KCNJ10-pot...121,50 € -
1 x GAK-cyclin...121,50 € -
1 x LSM1-LSM1...113,40 € -
1 x NEUROG3-ne...113,40 € -
1 x NCRNA00052...113,40 € -
1 x OAF-OAF...121,50 € -
1 x TCP10L-t-c...113,40 € -
1 x PNMA2-para...121,50 € -
1 x LGALS13-le...113,40 € -
1 x PARP16-pol...121,50 € -
1 x HOXB5-home...121,50 € -
1 x GLTP-glyco...113,40 € -
1 x KLHDC2-kel...121,50 € -
1 x C2orf15-ch...113,40 € -
1 x AKT1-v-akt...121,50 € -
1 x HSPA13-hea...121,50 € -
1 x EGFL8-EGF-...121,50 € -
1 x LST1-leuko...113,40 € -
1 x LYG2-lysoz...113,40 €
No products
To be determined Shipping
3 397,41 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 29 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 3 397,41 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 3 397,41 €
View larger 
CHST8-carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 8 Gene
PTXBC011380
New product
Data sheet of CHST8-carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 8 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CHST8-carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 8 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC011380 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CHST8 |
| Origin species: | Human |
| Product name: | CHST8-carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 8 Gene |
| Size: | 2ug |
| Accessions: | BC011380 |
| Gene id: | 64377 |
| Gene description: | carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 8 |
| Synonyms: | GALNAC4ST1; GalNAc4ST; PSS3; carbohydrate sulfotransferase 8; GALNAC-4-ST1; GalNAc-4-O-sulfotransferase 1; N-acetylgalactosamine-4-O-sulfotransferase 1; carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 8; galNAc4ST-1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaccctgcgacctggaacaatgcggctggcctgcatgttctcttccatcctgctgttcggagctgcaggcctcctcctcttcatcagcctgcaggaccctacggagctcgccccccagcaggtgccaggaataaagttcaacatcaggccaaggcagccccaccacgacctcccaccaggcggctcccaggatggtgacttgaaggaacccacagagagggtcactcgggacttatccagtggggccccgaggggccgcaacctgccagcgcctgaccagcctcaacccccgctgcagaggggaacccgtctgcggctccgccagcgccgtcgccgtctgctcatcaagaaaatgccagctgcggcgaccatcccggccaacagctcggacgcgcccttcatccggccgggacccgggacgctggatggccgctgggtcagcctgcaccggagccagcaggagcgcaagcgggtgatgcaggaggcctgcgccaagtaccgggcgagcagcagccgccgggccgtcacgccccgccacgtgtcccgtatcttcgtggaggaccgccaccgcgtgctctactgcgaggtgcccaaggccggctgctccaattggaagcgggtgctcatggtgctggccggcctggcctcgtccactgccgacatccagcacaacaccgtccactatggcagcgctctcaagcgcctggacaccttcgaccgccagggtatcttgcaccgtctcagcacctacaccaagatgctctttgtccgcgagcccttcgagaggctggtgtccgccttccgcgacaagtttgagcaccccaacagctactatcacccggtcttcggcaaggccatcctggcccggtaccgcgccaatgcctctcgggaggccctgcggaccggctctggggtgcgttttcccgagttcgtccagtacctgctggacgtgcaccggcccgtggggatggacattcactgggaccatgtcagccggctctgcagcccctgcctcatcgactacgatttcgtaggcaagttcgagagcatggaggacgatgccaacttcttcctgagcctcatccgcgcgccgcggaacctgaccttcccccggttcaaggaccggcactcgcaggaggcgcggaccacagcgaggatcgcccaccagtacttcgcccaactctcggccctgcaaaggcagcgcacctacgacttctactacatggattacctgatgttcaactattccaagccctttgcagatctgtactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide) - carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 9 - protein kinase C and casein kinase substrate in neurons 1 - interferon-induced protein with tetratricopeptide repeats 1 |