Login to display prices
Login to display prices
IFIT1-interferon-induced protein with tetratricopeptide repeats 1 Gene View larger

IFIT1-interferon-induced protein with tetratricopeptide repeats 1 Gene

PTXBC007091

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of IFIT1-interferon-induced protein with tetratricopeptide repeats 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about IFIT1-interferon-induced protein with tetratricopeptide repeats 1 Gene

Proteogenix catalog: PTXBC007091
Ncbi symbol: IFIT1
Product name: IFIT1-interferon-induced protein with tetratricopeptide repeats 1 Gene
Size: 2ug
Accessions: BC007091
Gene id: 3434
Gene description: interferon-induced protein with tetratricopeptide repeats 1
Synonyms: C56; G10P1; IFI-56; IFI-56K; IFI56; IFIT-1; IFNAI1; ISG56; P56; RNM561; interferon-induced protein with tetratricopeptide repeats 1; interferon, alpha-inducible protein (MW 56kD); interferon-induced 56 kDa protein; interferon-inducible mRNA 561; interferon induced protein with tetratricopeptide repeats 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagtacaaatggtgatgatcatcaggtcaaggatagtctggagcaattgagatgtcactttacatgggagttatccattgatgacgatgaaatgcctgatttagaaaacagagtcttggatcagattgaattcctagacaccaaatacagtgtgggaatacacaacctactagcctatgtgaaacacctgaaaggccagaatgaggaagccctgaagagcttaaaagaagctgaaaacttaatgcaggaagaacatgacaaccaagcaaatgtgaggagtctggtgacctggggcaactttgcctggatgtattaccacatgggcagactggcagaagcccagacttacctggacaaggtggagaacatttgcaagaagctttcaaatcccttccgctatagaatggagtgtccagaaatagactgtgaggaaggatgggccttgctgaagtgtggaggaaagaattatgaacgggccaaggcctgctttgaaaaggtgcttgaagtggaccctgaaaacccggaatccagcgctgggtatgcgatctctgcctatcgcctggatggctttaaattagccacaaaaaatcacaagccattttctttgcttcccctaaggcaggctgtccgcttaaatccagacaatggatatattaaggttctccttgccctgaagcttcaggatgaaggacaggaagctgaaggagaaaagtacattgaagaagctctagccaacatgtcctcacagacctatgtctttcgatatgcagccaagttttaccgaagaaaaggctctgtggataaagctcttgagttattaaaaaaggccttgcaggaaacacccacttctgtcttactgcatcaccagatagggctttgctacaaggcacaaatgatccaaatcaaggaggctacaaaagggcagcctagagggcagaacagagaaaagctagacaaaatgataagatcagccatatttcattttgaatctgcagtggaaaaaaagcccacatttgaggtggctcatctagacctggcaagaatgtatatagaagcaggcaatcacagaaaagctgaagagaattttcaaaaattgttatgcatgaaaccagtggtagaagaaacaatgcaagacatacatttccactatggtcggtttcaggaatttcaaaagaaatctgacgtcaatgcaattatccattatttaaaagctataaaaatagaacaggcatcattaacaagggataaaagtatcaattctttgaagaaattggttttaaggaaacttcggagaaaggcattagatctggaaagcttgagcctccttgggttcgtctacaaattggaaggaaatatgaatgaagccctggagtactatgagcgggccctgagactggctgctgactttgagaactctgtgagacaaggtccttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: