Login to display prices
Login to display prices
IFIT2-interferon-induced protein with tetratricopeptide repeats 2 Gene View larger

IFIT2-interferon-induced protein with tetratricopeptide repeats 2 Gene

PTXBC032839

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of IFIT2-interferon-induced protein with tetratricopeptide repeats 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about IFIT2-interferon-induced protein with tetratricopeptide repeats 2 Gene

Proteogenix catalog: PTXBC032839
Ncbi symbol: IFIT2
Product name: IFIT2-interferon-induced protein with tetratricopeptide repeats 2 Gene
Size: 2ug
Accessions: BC032839
Gene id: 3433
Gene description: interferon-induced protein with tetratricopeptide repeats 2
Synonyms: G10P2; GARG-39; IFI-54; IFI-54K; IFI54; IFIT-2; ISG-54 K; ISG-54K; ISG54; P54; cig42; interferon-induced protein with tetratricopeptide repeats 2; Interferon, alpha-inducible protein (MW 54kD); interferon-induced 54 kDa protein; interferon-induced protein 54; interferon induced protein with tetratricopeptide repeats 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagtgagaacaataagaattccttggagagcagcctacggcaactaaaatgccatttcacctggaacttgatggagggagaaaactccttggatgattttgaagacaaagtattttaccggactgagtttcagaatcgtgaattcaaagccacaatgtgcaacctactggcctatctaaagcacctcaaagggcaaaacgaggcagccctggaatgcttacgtaaagctgaagagttaatccagcaagagcatgctgaccaggcagaaatcagaagtctggtcacctggggaaactatgcctgggtctactatcacatgggccgactctcagacgttcagatttatgtagacaaggtgagacatgtctgtgagaagttttccagtccctatagaattgagagtccagagcttgactgtgaggaagggtggacacggttaaagtgtggaggaaaccaaaatgaaagagcgaaggtgtgctttgagaaggctctggaaaagaagccaaagaacccagaattcacctctggactggcaatagcaagctaccgtctggacaactggccaccatctcagaacgccattgaccctctgaggcaagccattcggctgaatcctgacaaccagtaccttaaagtcctcctggctctgaagcttcataagatgcgtgaagaaggtgaagaggaaggtgaaggagagaagttagttgaagaagccttggagaaagccccaggtgtaacagatgtacttcgcagtgcagccaagttttatcgaagaaaagatgagccagacaaagcgattgaactgcttaaaaaggctttagaatacataccaaacaatgcctacctgcattgccaaattgggtgctgctatagggcaaaagtcttccaagtaatgaatctaagagagaatggaatgtatgggaaaagaaagttactggaactaataggacacgctgtggctcatctgaagaaagctgatgaggccaatgataatctcttccgtgtctgttccattcttgccagcctccatgctctagcagatcagtatgaagaagcagagtattacttccaaaaggaattcagtaaagagcttactcctgtagcgaaacaactgctccatctgcggtatggcaactttcagctgtaccaaatgaagtgtgaagacaaggccatccaccactttatagagggtgtaaaaataaaccagaaatcaagggagaaagaaaagatgaaagacaaactgcaaaaaattgccaaaatgcgactttctaaaaatggagcagattctgaggctttgcatgtcttggcattccttcaggagctgaatgaaaaaatgcaacaagcagatgaagactctgagaggggtttggagtctggaagcctcatcccttcagcatcaagctggaatggggaatggagaatagagatgtggtgcccactaggctactgctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: