Login to display prices
Login to display prices
OGDH-oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide) Gene View larger

OGDH-oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide) Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of OGDH-oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about OGDH-oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009580
Product type: DNA & cDNA
Ncbi symbol: OGDH
Origin species: Human
Product name: OGDH-oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide) Gene
Size: 2ug
Accessions: BC009580
Gene id: 4967
Gene description: oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide)
Synonyms: AKGDH; E1k; OGDC; 2-oxoglutarate dehydrogenase, mitochondrial; 2-oxoglutarate dehydrogenase complex component E1; OGDC-E1; oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide); oxoglutarate decarboxylase; oxoglutarate dehydrogenase (succinyl-transferring); testicular tissue protein Li 131; oxoglutarate dehydrogenase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtttcatttaaggacttgtgctgctaagttgaggccattgacggcttcccagactgttaagacattttcacaaaacagaccagcagcagctaggacatttcaacagattcggtgctattctgcacctgttgctgctgagccctttctcagtgggactagttcgaactatgtggaggagatgtactgtgcttggctggaaaaccccaaaagtgtacataagtcatgggacattttttttcgcaacacgaatgccggagccccaccgggcactgcctaccagagtccccttcccctgagccgaggctccctggctgctgtggcccatgcacagtccctggtagaagcacagcccaacgtggacaagctcgtggaggaccacctggcagtgcagtcgctcatcagggcatatcagatacgagggcaccatgtagcacagctggaccccctggggattttggatgctgatctggactcctccgtgcccgctgacattatctcatccacagacaaacttgggttctatggcctggatgagtctgacctcgacaaggtcttccacttgcccaccaccactttcatcgggggacaggaatcagcacttcctctgcgggagatcatccgtcggctggagatggcctactgccagcatattggggtggagttcatgttcatcaatgacctggagcagtgccagtggatccggcagaagtttgagacccctgggatcatgcagttcacaaatgaggagaaacggaccctgctggccaggcttgtgcggtccaccaggtttgaggagttcctacagcggaagtggtcctctgagaagcgctttggtctagaaggctgcgaggtactgatccctgccctcaagaccatcattgacaagtctagtgagaatggcgtggactacgtgatcatgggcatgccacacagagggcggctgaacgtgcttgcaaatgtcatcaggaaggagctggaacagatcttctgtcaattcgattcaaagctggaggcagctgatgagggctccggagatgtgaagtaccacctgggcatgtatcaccgcaggatcaatcgtgtcaccgacaggaacattaccttgtccttggtggccaacccttcccaccttgaggccgctgaccccgtggtgatgggcaagaccaaagccgaacagttttactgtggcgacactgaagggaaaaaggtaaggcccagagagaggcgtgcaaggcagatcgtcaaggccccatgttccagcatggagttccgctcaccaacataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 9
- protein kinase C and casein kinase substrate in neurons 1
- interferon-induced protein with tetratricopeptide repeats 1
- interferon-induced protein with tetratricopeptide repeats 2